Gene CALD1 Variant 1
DNA : 189.69 KbNT_079596
mRNA : 3612 bp NM_033138
CDS : 2382 bp NP_149129
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  100 bp
catccaccttggctggggtgtcgtcattggctgcctattagaaaaacgacaggacaatgc
ataccaccgcctcccgactgtaaacataggggatatgtgttcacttagcatggacttctg
ggaggggccaaggaagggcggtctggagttttattgaatagagcagtgtgtattcggctg
CCTGCCTGCCCGCCTGCTTGCTCTCTGGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCC
TTTCCGACTTAGTCCTCGGGAAGAAGTTTCAGACTACAAG
gtaaggcacagaaggctttcttttttatcttctagagagaatctggggactttctccggc
tttcagtcaacattcctggctaaggtagctggagatgcaagaatgttcaaggcaataaac
catgcaaactcccgagcctgactgggcttcactgccatacggatattcccggaaggcaaa
EXON 2  88 bp
ataactgtattttccttaaaatgcaaatgcacaatagctatttctacccctgccttactt
ctccctttagattctaactaacaacagtacttgaggaagaaatgatatttgaaaatatat
agtctgtattagctaaaattcattcaactgaattatgtttccatcctccttttattccag
GTATCATTGGAACATTTCAAGATCATCAAATCAAATTCCACAGGGATTGGTGACCAACCA
GAAGGCTCAGACATCTGATTGCTGACCT
gtgagtaaagtttatgttttattaatactttgggctctgctcttaggaattacacagcct
ctgtgcctgatattctaaattcttacatctgaagatgcactgtgagaaaccagtttttct
gctgtggccctcctactttacttgccagttaattaatcagttagaatctatcaagttttg
EXON 3  112 bp
tgaatgagactgaatttaactcggctcaggagtcagaaattgatcactggctaccttatc
agctttctaagagtaaagaaaaatcaggagaatgacaaatgggaaagagggcccatagta
actcaggagaagtaacacactgagttatcaatgatattgactctacctcctctctttcag
GTCCAGACATCATCTGGTCTCCCTGAACCTGAAATCACACCATGGATGATTTTGAGCGTC
GCAGAGAACTTAGAAGGCAAAAGAGGGAGGAGATGCGACTCGAAGCAGAAAG
gtaaggatctagggtgaaaaatacttgtattcccttattaacaaccttggtttcaggcct
caaagaccatccttttgagaggccaaatgtggtcatatcgcacaccaaactgttcgcaaa
agtagttatggaaaatttttctgctaagactctaaattaagcatttaaaaaaggaaaaca
EXON 4  147 bp
aaaagtttgaaagctagctgactaggtcgctaaacttaaggaactgaaccatccttttag
acgtatgtggttcattaagcagtgaagttcagaaaagggctcagggctgttcctgccaag
aggttggtgaagacacgtggcaagtggcacgctcaagaggttgtctttgtaatgttgcag
AATCGCCTACCAGAGGAATGACGATGATGAAGAGGAGGCAGCCCGGGAACGGCGCCGCCG
AGCCCGACAGGAACGGCTGCGGCAGAAGCAGGAGGAAGAATCCTTGGGACAGGTGACCGA
CCAGGTGGAGGTGAATGCCCAGAACAG
gtactgtcctctttgggacggggagtttctaacttgcgtcttagcctgtccgttgaatgg
aatttgttgagcagagcattcctttctcagcccaactcaaccctttttcaatctaactgg
tttaattattttgcagtcattttaggcaactaatctgattagacaggcaatctgatttag
EXON 5  1090 bp
cttgcaaatgctgtcagctgaaagccaggcaggcgtgtactaaaatggtaacgtactggg
gatatgggcaagcttggcactactggcatctgctgtagtcctgggtagcacaggctgtat
gaatgctgctgactgatgaatgagcaagctgtctttggtgttgttctttctgttgtacag
TGTGCCTGACGAGGAGGCCAAGACAACCACCACAAACACTCAAGTGGAAGGGGATGATGA
GGCCGCATTCCTGGAGCGCCTGGCTCGGCGTGAGGAAAGACGCCAAAAACGCCTTCAGGA
GGCTCTGGAGCGGCAGAAGGAGTTCGACCCAACAATAACAGATGCAAGTCTGTCGCTCCC
AAGCAGAAGAATGCAAAATGACACAGCAGAAAATGAAACTACCGAGAAGGAAGAAAAAAG
TGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAACAGTCACCAAGTCCTACCA
GAAGAATGATTGGAGGGATGCTGAAGAAAACAAGAAAGAAGACAAGGAAAAGGAGGAGGA
GGAAGAGGAGAAGCCAAAGCGAGGGAGCATTGGAGAAAATCAGGTAGAGGTGATGGTGGA
AGAGAAAACAACTGAAAGCCAGGAGGAAACAGTGGTAATGTCATTAAAAAATGGGCAGAT
CAGTTCAGAAGAGCCTAAACAAGAGGAGGAGAGGGAACAAGGTTCAGATGAGATTTCCCA
TCATGAAAAGATGGAAGAGGAAGACAAGGAAAGAGCTGAGGCAGAGAGGGCAAGGTTGGA
AGCAGAAGAAAGAGAAAGAATTAAAGCCGAGCAAGACAAAAAGATAGCAGATGAACGAGC
AAGAATTGAAGCAGAAGAAAAAGCAGCTGCCCAAGAAAGAGAAAGGAGAGAGGCAGAAGA
GAGGGAAAGGATGAGGGAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCAGAGGATAAAGGA
GGAAGAGAAAAGGGCAGCAGAGGAGAGGCAGAGGATAAAGGAGGAAGAGAAAAGGGCAGC
AGAGGAGAGGCAGAGGATAAAAGAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCAAAGGGC
CAGGGCAGAGGAGGAAGAGAAGGCTAAGGTAGAAGAGCAGAAACGTAACAAGCAGCTAGA
AGAGAAAAAACGTGCCATGCAAGAGACAAAGATAAAAGGGGAAAAGGTAGAACAGAAAAT
AGAAGGGAAATGGGTAAATGAAAAGAAAGCACAAGAAGATAAACTTCAGACAGCTGTCCT
AAAGAAACAG
gtacagtaaacattttgcaccaaatgtgtgatgcctgtgacttgtgagaaatgtaatgca
catctgatttgggactgaggccacatgcatatagctcacatgcttgatcatttggcaagc
tgttcattttttcaggccatagcgatacacaagcatgcagcaattgattgatggctgaat
EXON 6  78 bp
ggggtgggaagaaaatatcccaccttgctgtttagaaccactgtgctgtgagcgctgaga
cggcagaagagaagccatcccacgcagcacttgcaaggcgatccgagcaccctgtcactc
ttgtaaactagaaagggcttcttttacttgtgtgaccttaccattcttgaaaataaaaag
GGAGAAGAGAAGGGAACTAAAGTGCAAGCTAAAAGAGAAAAGCTCCAAGAAGACAAGCCT
ACCTTCAAAAAAGAAGAG
gtaaatatgattgaaaagtaatgatcgtaaagcaacagaaaaagcagtcagtgttccaag
atatctcaggtctgatgatctcaaaattgtaacctcatatccagtgtatttcaagccatg
actcacagtccactgaatagtgagatcagcttagagtgtctcaaaattaattaaatgtat
EXON 7  146 bp
gctaaaggaccatagctcattctctaagaatttcacctgattccaactctaccacatctg
agtggtttctttctgagttttctgccttcctaacaattttgggtcttacttgatgatacc
aaccaaaacctaataagatttttcttgttctgtttcttcctgatatgtactgttggttag
ATCAAAGATGAAAAGATTAAAAAGGACAAAGAACCCAAAGAAGAAGTTAAGAGCTTCATG
GATCGAAAGAAGGGATTTACAGAAGTTAAGTCGCAGAATGGAGAATTCATGACCCACAAA
CTTAAACATACTGAGAATACTTTCAG
gtaagaagtagcaactagttaatagaaactgtgttcacatgcaaagaaaaaaaaaaaaaa
gtcagtcttcccatcctgtgcttccagacagaaacgtgctaagcaggcagcatgcttttg
ttgtgaggtcattagccattgtcttagagatactcagtcagcaggtccagttcttatatc
EXON 8  262 bp
agcagaggctcctggactctgtgattccgggcagaccccttccccagcctaccccctggg
ctaatgagaggcagtgggtatttagtcggggatgcagaagccgcagaccgacctcccctt
cctccagggagactacaggcaaaagcatgtaaacccctttccattgccccccaaccacag
CCGCCCTGGAGGGAGGGCCAGCGTGGACACCAAGGAGGCTGAGGGCGCCCCCCAGGTGGA
AGCCGGCAAAAGGCTGGAGGAGCTTCGTCGTCGTCGCGGGGAGACCGAGAGCGAAGAGTT
CGAGAAGCTCAAACAGAAGCAGCAGGAGGCGGCTTTGGAGCTGGAGGAACTCAAGAAAAA
GAGGGAGGAGAGAAGGAAGGTCCTGGAGGAGGAAGAGCAGAGGAGGAAGCAGGAGGAAGC
CGATCGAAAACTCAGAGAGGAG
gtaaggcgggcgctagcccactgagaacgttgcccgggaaaattccctagtgccgtgcgg
ctgttcttttgagcatgggctctcaaaaatatttttttaagaataataaacttaccatgt
gctaggtactgttttataacttgtagatgtattaatttgtccactgcttctaagaactcg
EXON 9  141 bp
aaatgcaggcagctcgactccagctctcaggctaaacctctggtgaccacctagaagggg
agtgtccagcctgcggcctgagtctgctgcctctccaactgtgctctctctcctacagca
ctcttccctttggctgtgaagctggtactgatgcctcgttatttgttctttctctcttag
GAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGAGCAGAAGCTGCTGAGAAA
CGCCAGAAGATGCCAGAAGATGGCTTGTCAGATGACAAGAAACCATTCAAGTGTTTCACT
CCTAAAGGTTCATCTCTCAAG
gtatttttttccccagaaaacttctattagaatatgatagagactggattttagcccctt
gtttagttattgattatacagggcctttgttcatttatctttttgctatccttccaagtt
aatctgttcaggctgctataacaaaatactttagactggggccaggcacggtggctcatg
EXON 10  44 bp
cactatcaaataccttatatgtagttttgctttctagcagagctacgcacagtaactcaa
atacccttatatgctcttcggtgtgtttaacaggttcagggatgatattggcctgggctg
agaaacactgtttataagcttgaaatattaattgggtttattttcttttgtaattcctag
ATAGAAGAGCGAGCAGAATTTTTGAATAAGTCTGTGCAGAAAAG
gtaaatatgcttgatggttcaattgagctaatcagctagcatatgtatgagaagattctc
tctcatatttttatatgtatgtgtttacttttttagcagtggtgtcaaatcgacccatca
agcagcaatagtctccaagattgacagcagactggagcagtataccagtgcaattgaggt
EXON 11  82 bp
tgaaatattaattgggtttattttcttttgtaattcctagatagaagagcgagcagaatt
tttgaataagtctgtgcagaaaaggtaaatatgcttgatggttcaattgagctaatcagc
tagcatatgtatgagaagattctctctcatatttttatatgtatgtgtttacttttttag
CAGTGGTGTCAAATCGACCCATCAAGCAGCAATAGTCTCCAAGATTGACAGCAGACTGGA
GCAGTATACCAGTGCAATTGAG
gtgagaattgtcctcagcgttatggtcctgctgaacagaaatagattctgactacataga
agagcataaaaacacttaggacaataatcaagtccaatagccccaggagtgttagaattt
tttttttttttttttttgagacggagtctcactctgttgcccaggctggagtgcaatggc
EXON 12  138 bp
ttttgagggacatatgtcatcagcatacagttttacaacagaaattatcactctcatttt
tggtggaggtgtttacacaatgaatttttaagatgataatgttgaggaagacaaactcac
tataattttatgagaacaaacttcccagcaccaatcctaaaaataactcacaaatttcag
GGAACAAAAAGCGCAAAACCTACAAAGCCGGCAGCCTCGGATCTTCCTGTTCCTGCTGAA
GGTGTACGCAACATCAAGAGTATGTGGGAGAAAGGGAATGTGTTTTCATCCCCCACTGCA
GCAGGCACACCAAATAAG
gtgagcatctgatttttgtctcttaagtgtagaggggcatatttttttgcatgtcgattt
tgatttaggaatcacactagtaaataataaaagcagtgaagaaggtgcaatttgtacttt
gttttgcaatgaccacaaaagcaagctcagagagaatgtgtttgtgaggttgcatgaggt
EXON 13  96 bp
ttggagtggggtgagttaccagggaaagaaaaccagataacatattctgtaaatatcaag
tgttaaggtttatggttatgtgaaatcatacttaatgatattttgaatttgctttgaaaa
ttccttcccaggtaaagtttacttcattctttaatattttggatgattgcccctttgtag
GAAACTGCTGGCTTGAAGGTAGGGGTTTCTAGCCGCATCAATGAATGGCTAACTAAAACC
CCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCT
gtaagtacctttaggtttttctgagtttctttgatctcccagcttctaccagcagaagaa
aacaagcagttggtctgtttacctaggaatggcagtgcccctgttctttgctttccctga
tgaatagcaaacaggaaagtgttcagatttacaacagttctaagaagctgcatctcagtt
EXON 14  81 bp
aaaaaataaaaaaatcaaacaacagctgatggtcctttcaattccatttcagatcactgg
ggtaaagtgtattaaacaacaaactgattcaaataaacaatagatgtggccatttattta
gagctggctagaaaatataaatggccacctatcgatgtttttctgcttcctttttatcag
GACTTGAGACCAGGAGACGTATCCAGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGAT
AAGGTCACTTCCCCCACTAAG
gtaatctattgggaagactagtatttcagaggtttgttttcctgatgtatggtgtagtat
aatgtcctggagtcagatgagaaatatcactgacctacagatctttgcctgcacacccat
cagtgtctaaaagaccagtacataacacagtgaaatgaaaagcgcattgcaagtttgtca
EXON 15  1007 bp
gtaaaataaaagatcatatttgaatggaatgccgataataatcctccctttcataaatat
ttattcctgccatactattattcatttttcttctgactataaaaaccatctgcctgaaac
actgcaggctgtcagtttcacactacaggctgtcaatttcaagttctcttctcttggcag
GTTTGAGACAGTTCCAGAAAGAACCCAAGCTCAAGACGCAGGACGAGCTCAGTTGTAGAG
GGCTAATTCGCTCTGTTTTGTATTTATGTTGATTTACTAAATTGGGTTCATTATCTTTTA
TTTTTCAATATCCCAGTAAACCCATGTATATTATCACTATATTTAATAATCACAGTCTAG
AGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAAAGAAACCCATGC
TGTGAAATAGAGACTTTTCTACTGATCATCATAACTCTGTATCTGAGCAGTGATACCAAC
CACATCTGAAGTCAACAGAAGATCCAAGTTTAAAATTGCCTGCGGAATGTGTGCAGTATC
TAGAAAAATGAACCGTAGTTTTTGTTTTTTTAAATACAGAAGTCATGTTGTTTCTGCACT
TTATAATAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTTTGAAAGTAA
CCCATTTCAGATTTGAAATACTGCAATAATGGTTGTCTTTAAAAAAAAAAAAGAAATGTA
CTGTTAAGGTATTACTTTTTTTCATGCTGATGATTCATATCTAAATTACATTATTATGTT
AGCTGACAGTGGTACTGATTTTTTAGGTTGGTTGTTTTGTGGATTTCTTTAGTAGTGATA
GTAGCCTGAACCACATTTTAGATAACTCAATTATGTATGTATGTGCATACACATATACAA
ACACACTAATGGTAGAATGCTTTTTTATGTGCTAGACTATTATATTTAGTAGTATGTCAT
TGTAACTAGCCAATATCACAGCTTTTGAAAAATTAAAAAATCACACTATATTAATATTTT
ATATTTGCCAACAGAAACATGGCAGATAGGTATCAATATGTTTTCAATGCCTGATGACCT
ATAAGAAGAAAGTATTGAAAAGAAGAGAGATTAGAACTGTTAGAAGGAGTTGAAATTTTC
TAAAAGACATAGTATTTAGTTTATAATTAAATGCATTCTTGAAGTCC
agtgtgaattttattaatgctatcatctcgaccaagctcaaagcctacttattagaaaca
atgaagttcacaataggtcataaggtctcttccttttctaaaattgaaagacaagaaatt
tagtgccaatattgtacagacagaaattccatgtatgagtctcaacaaagactacctttg