Gene AZGP1 Variant 1
DNA : 9.01 KbNT_079595
mRNA : 897 bp NM_001185
CDS : 897 bp NP_001176
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  76 bp
tgtagattcattcttcataacctctgcccagcctagcttgtgtatcatttttttttctct
attaggggaggagcccgtcctggcactcccattggcctgtagattcacctcccctgggca
gggccccaggacccaggataatatctgtgcctcctgcccagaaccctccaagcagacaca
ATGGTAAGAATGGTGCCTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCC
CAGGAGAACCAAGATG
gtgagtggggaaagcaagggatgggtgctggagaggactggaaggaggtgaggaacagga
catgtggctgggagacaggctggatgcagctgggataccctggcatacggcaggaatggg
tgcccaaggctgtcaactccctcagctcacacacttccaggagcattcagggagcctctg
EXON 2  261 bp
catctcaggcatgaaagtagagcatattcacttgagtgagcctccagtggtgtgaagttg
atggcaggagaaagagctggggaagaaaaggccagtggcaggtctcccctcctagcccta
tgcagccccacagtgggacccttgcatggacctcaaccatcagaatcttttcttttgcag
GTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCG
CGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACA
GGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGG
ACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGG
AGTATTACAACGACAGTAACG
gtcagtgaataacagaccacaggggtggaaggtctaacccaagaggcagcccccccagtg
tgagtggcaagggatcagcaggatggaaatagtcccaatcccaggggaagaacaggagac
acagcagaaacacagacatgtccacatcccacccaccccacagcacaggtgctccccgct
EXON 3  276 bp
ccctctctgtctgttgtatatattggagtaataacctatttgtcttgataaagggattgc
atgcttgaattgcaaaaacctttatttcttttgggttgcccaatgtgcaagactaagagt
tattttgataaatttctcaccaggctgactgtctctctgtggggtcgggggagttttcag
GGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAG
CATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAG
CCTGGGTCCCCTTCGACCCAGCAGCCCAGATAACCAAGCAGAAGTGGGAGGCAGAACCAG
TCTACGTGCAGCGGGCCAAGGCTTACCTGGAGGAGGAGTGCCCTGCGACTCTGCGGAAAT
ACCTGAAATACAGCAAAAATATCCTGGACCGGCAAG
gtactcactgcttcctgctccccagtactgagcccagaataaaagacgatctcaggctag
gagctcaggcaacatcttagtccggtctcatctgttcctggatgtccctcagacccccag
ctttcatcttttaggatttattccttccctgggataatataatttgtggtccaaaaagaa
EXON 4  284 bp
ggcaagagggaaagcgtcagccttccctgatattctggaaagtctcccggggctgggggt
gggcaggtacagagcttcgagctctgctgatcgctgacatccaggggtgggggtaggaag
agacctgggccgggagaagtccacctcaagcctgcagtgtcacactctatccctccacag
ATCCTCCCTCTGTGGTGGTCACCAGCCACCAGGCCCCAGGAGAAAAGAAGAAACTGAAGT
GCCTGGCCTACGACTTCTACCCAGGGAAAATTGATGTGCACTGGACTCGGGCCGGCGAGG
TGCAGGAGCCTGAGTTACGGGGAGATGTTCTTCACAATGGAAATGGCACTTACCAGTCCT
GGGTGGTGGTGGCAGTGCCCCCGCAGGACACAGCCCCCTACTCCTGCCACGTGCAGCACA
GCAGCCTGGCCCAGCCCCTCGTGGTGCCCTGGGAGGCCAGCTAG
gaagcaagggttggaggcaatgtgggatctcagacccagtagctgcccttcctgcctgat
gtgggagctgaaccacagaaatcacagtcaatggatccacaaggcctgaggagcagtgtg
gggggacagacaggaggtggatttggagaccgaagactgggatgcctgtcttgagtagac