Gene AUTS2 Variant 1
DNA : 94.73 KbNT_079593
mRNA : 4963 bp NM_015570
CDS : 3092 bp NP_056385
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  54 bp
gcactgcaggtctctctcaagcagtcaactagcaccaccttatggatgatttggggacat
tgctgcttccctgctaggctttcgtaaaatgtagtcaactgatttaaaataatgggaatg
ttgatggtgatgacaatattaatgacaataataatgcttttttcccccttcttgtttttc
AGGCATCAGATGCCAGCTCTGAAAAACTCTTCAACACTGTTATTGTAAACAAAG
gtaagacccattcattctcctgagtaatggcttatttttatgttagtttcattgtcattg
cctaggaagaaagaagagctagagtgatctttctcttataattctgaagctactgttgat
gtttcatgtttttgcttgagatggaagtctgcatactttgtgatgcattaacattaacaa
EXON 2  472 bp
tgaccccatttgctgtgggcgcatacccccgcaggtggtggagacaaggacccaagccag
gagggttggtgccaggtcctgttgctggagttgtgtgatagccttggagtttcctttccc
tccttacgccacactcgcatgtcattgcctgtggttttgtctttgctctctcccatgcag
ATCCGGAGTTAGGTGTTGGCACGCTACCAGAACATGACAGCCAGGATGCAGGGCCGATTG
TCCCCAAGATATCGGGTCTAGAGAGAAGCCAGGAGAAGAGCCAGGACTGTTGCAAAGAGC
CAATCTTTGAGCCTGTGGTGCTTAAAGACCCCTGCCCTCAGGTCGCACAGCCAATACCCC
AGCCGCAGACGGAGCCCCAACTCCGAGCTCCTTCTCCGGACCCTGACTTGGTGCAGCGCA
CAGAGGCCCCACCTCAACCCCCACCTCTGAGTACACAGCCACCACAGGGCCCTCCTGAGG
CCCAGCTCCAGCCTGCCCCGCAGCCTCAGGTGCAGAGGCCACCCAGGCCACAGTCCCCCA
CCCAGCTGCTCCATCAGAACCTCCCACCTGTGCAGGCCCACCCCTCTGCTCAGAGCCTCT
CCCAGCCATTGTCAGCCTACAACAGCAGTAGCTTAAGCCTCAACAGTTTAAG
gtgagtggcctgctcttctttggcctgacttttgccctctccctggggatcaggtgggtg
ggagtcggggagggatccctagggagactgaggtttccttgttggaaacatcatcctttt
ctctgagactagagacagggaatggggctgttgggtgagactcgggtctcttgggaaagg
EXON 3  254 bp
ggaaagtttgcaggagttgtgatttcagaaagtgtgcgcgtacagggaggatctgtaaag
aggaaggggcaagagagactgtggtgagggtttaggggaaggaggtaggattcttttaaa
gagaatacattgcttacctttttttatttttttcttttcttttttttcttgttccgatag
CAGCAGCAGAAGCAGCACTCCAGCGAAGACTCAGCCCGCCCCACCTCACATCTCCCACCA
CCCCTCTGCCTCCCCGTTCCCCCTCTCCCTGCCCAACCACAGCCCCCTGCACAGCTTCAC
ACCCACCCTCCAGCCCCCCGCACACTCACATCACCCCAATATGTTTGCCCCTCCCACTGC
TCTGCCTCCTCCACCACCACTGACATCAGGAAGTCTGCAGGTGGCCGGACACCCGGCCGG
GAGCACTTACTCAG
gtaggacggaggggcctgtgctcgtgaccccgacccccaccgcccctcgctgtgacctca
ccctacctatgttgtcccgattgcaaggttgcatttgcctacaattttttccttccttac
tgtgatcttcctcaaacgctctctggcctgaggtccagcaaaaatacctgtcagcaccca
EXON 4  221 bp
gggtgcgaccgggccttggtctcgtctgcttcattgattgcccccgtttatctcagggcc
cagccacaccctgtcacccctgccactgtgtcaccagccccgtacccctccacaggaagg
cagtccgatgtccttttctgaaggaaaaggcgtcatcgtctccctcttcttctcttccag
AGCAAGACATCTTGCGACAGGAACTGAACACTCGTTTTTTGGCCTCTCAGAGTGCTGACC
GCGGGGCTTCCCTGGGCCCTCCGCCCTACCTGCGGACCGAGTTCCATCAGCACCAGCACC
AGCACCAGCACACCCACCAGCACACGCACCAGCACACCTTCACGCCGTTCCCCCACGCCA
TCCCACCCACCGCCATCATGCCGACGCCAGCACCTCCCATG
gtgcgtaccccaggcagaaatgtgaggataagtagagcacgactcttttctttatgcagc
acgtgggaccgggctgggcagcggggccaccagagatcgaatggggactgacggctgttg
gctggagagaagggaatgtgtcctagtgccctgcctcaggcagctctgacttcaggggcc
EXON 5  45 bp
ttccatttctgttggcttcttgtcagggagactcaggagctcagaatggtttcatatgta
atgaggttatggggtctcatgacagcttaatgacagggaagctttgtagggccacctcca
ctgtagcagtgaacaaaaatgcagattaagtaactagcttttgctttgatccctttacag
TTTGACAAATACCCTACAAAAGTTGACCCATTCTACCGGCACAGT
gtgagtttcattaccatgctacacattgaatgtaactgctttgccatttttgtgctcttg
ccacagatcagtcaatgactagcagccttccttaatcatctttgcaagagttcccattgc
tcctcgccactttggatgcttgcttttgtggtgttttgcttttggtaaagatgcagtatc
EXON 6  96 bp
tttaagttacacattcgtggcacgtctgtgtgatcattccatcatggcttcttgactaat
ggcatcaaactgagattacgtggcttgctcatgtcgatgtctttctatgggacgggaatt
tgaatatgtcacttgcctcctactaaaatcttttttccccctctccgtctttggccacag
CTCTTCCATTCCTATCCTCCTGCAGTGTCGGGCATCCCCCCTATGATCCCACCCACTGGC
CCTTTTGGTTCACTACAAGGAGCATTTCAGCCGAAG
gtaagaaacctcacagtgaaaacacacaggcatgtgtctaagtggcgtcccgggccaggc
gtgcaggaagttctgcgtcctcttgcctgtgcagtgactcattaatcaggtcctaagtga
ccactgggattagagtgagcctatttttcttttttttccaagtccatctagttttaaatg
EXON 7  72 bp
ctgtggtcaggcccccttgagaaagagcatgtgtggtccctgagaaaaatgaatcttgcg
tttcagaaggaaacaaacaaatgaagtttggcttctctcatttagcagaagggaaggatc
ttgctttcatgtcacctgttttgtgcttcctaagtaagctgtggtctaattaatttgtag
ACATCCAACCCTATCGATGTCGCTGCTCGGCCTGGGACAGTCCCACACACTTTACTCCAA
AAGGACCCGAGG
gtacgtgcaaagtcaggcttggtctcaggtaacaccagggtgtgtgtgtttgcacgggac
ggccagcccagtgctcgcatcttccttagctcctttgagcgagctgctgtttcagctgtt
cttctagtttgtggaagaaaatgccaattactcttagaaaacacagtctctcctgctcac
EXON 8  30 bp
ggggacacttggcacttttgatagtgtgaaaatgggttaattattctctaaaagggcttc
atttaaaagtaaaattctaacattttaatttcccctcctaatgaagcactacaaatttgt
taattagagcaattgtttgagtgacaggcatgtaaccaagttgtcattttctcttcacag
TTGACAGATCCTTTCAGACCTATGTTAAGG
gtaagaaagcttcttatagaactgttttgcaacctctatttgactccctgtgggttaaaa
atacaagtctattacaaggaaataagccatagaaatgttggaataagacattggaatgac
ggtgattgggtttttcagatagtgtgattgaaaatggcctaaactgttttgctttgaccg
EXON 9  72 bp
tgactcccttatgactgggcgctggagagctactgatggaaggcacttggagagtacaaa
gcactcttgtttcacgaaaaaagcctctgcagccaaaatctgctgaaagctttggggaaa
ttgaaggtggttttctctgaaatgtcttcctcctaaccacgttgctctttcttgttccag
AAACCAGGGAAGTGGTGTGCTATGCATGTTCACATCGCCTGGCAGATTTACCACCACCAA
CAGAAAGTCAAG
gtcagtccgaccttcgtggtgtagggaagaatgggatgcacatgtgagtgtgtgacgtgc
tcgggagaacctgatgaaggaggcatttaaaacacattttacagacccatagttaggaag
gatcaagcctctcttggaaaagctactcagaagtcttacttattttttcctagagtcagg
EXON 10  142 bp
taccggcctgcagatctgacatttgagggtgaaatggtttttgtgtagctgctttctctc
acagtgtttgtaaacttgaacccaagtgcaccgttcacagtctccagctccagctcttca
ctaacacctttattccttgctgttggccttgggacccttactgttccccttgctgtgtag
AAACAGATGCAGTCAGACCCACATAAGCTGGACTTTGGACTGAAACCTGAGTTCCTGAGC
CGCCCTCCAGGCCCCAGTCTTTTTGGAGCCATCCACCACCCCCATGACCTGGCACGGCCT
TCAACTTTGTTCTCTGCCGCTG
gtgagtgtgggtttgggtggggggacagagctgagaaatgtagttctcaggtaactaaat
aaatgaggtttgggctctgagctgccgctcagtcaccacctacaaaaatacagttaatgc
cagcttgcaaggcaacatcgcagcacatccagggagttgggaatcttcattgatacactc
EXON 11  78 bp
aaaaaaaaaaaaaccacattttcttttaccctgtgtcttgcctgcaggggcctgggtgga
cttcagccatgacctcccttgaacatattttctcacggggcccttaagcaagtagaagcc
agttgcatcttcgaagttggctttttgtaaactctggttttgttatgtttgacttaacag
GTGCTGCACACCCAACTGGGACCCCTTTTGGGCCACCTCCTCATCACAGCAACTTCCTCA
ACCCTGCTGCCCACCTAG
gtgagtcgcccaaaataatgggaactgagatgtgtgcttcaggcaaccctgctgtgttta
ccatgctcccgctgcacctccgggcaagctggtgggagtcccagataccctgcttaccac
ttaggcaggagatggtgctctcttaggagtttcagtacatcccgtccagcttccagattt
EXON 12  84 bp
cccagtgcctaaatccaagtgtaatgaaaaccttttacaccatctggtaggaaaagtggg
acaggccaggtgggggcgtagagagggcagggatcccgcatcgccctgctcccaggaagc
tctgggttcctctcccagcagagcccctgaccatttccttcttccccatcttgtttgcag
AGCCTTTTAATCGGCCGTCTACATTCACAGGCCTAGCAGCAGTTGGTGGCAATGCCTTCG
GGGGACTTGGAAATCCTTCCGTTA
gtgagtacctctaacttttaaaaatctgccttggactttttatctcctgtgatccgcata
tggctcaagacctttctagagaaaaggaaactatgctctggggggaccagtgtaggttat
atcactgcaaaagcaggccttcacagtggggtgaggtggaagtgtgcagagccaccactg
EXON 13  223 bp
tccagtgtaggacaagacttcctctaatgaatttgttaatctcctttccttttccagctc
ccaataatatgtattcattttaactctgaatgctgttaaaagttttttggtaagtacctt
cattacagcagattatataatttctcttaaacctttttgttctccacttcgccatttcag
CACCCAACTCAATGTTCGGCCACAAGGATGGCCCCAGTGTGCAGAACTTTAGCAACCCTC
ACGAACCCTGGAACCGGCTGCACCGAACGCCTCCGTCGTTCCCGACCCCTCCGCCCTGGC
TGAAGCCAGGGGAGCTGGAGCGCAGCGCGTCCGCTGCAGCTCATGACAGAGATAGAGATG
TAGATAAACGAGACTCATCTGTTAGTAAAGATGACAAAGAAAG
gtacggaaagaaaccgctctcgagtccccacgggggagcctgctctatgccaagtaccag
tggaactggccgcccaccctccctgtcccagcctcgtgctttagccgccccggtagcctc
agctcctccccacagccagtgcccgcagcccctcgcagtccccatggcccgtagcatatg
EXON 14  3120 bp
ggtaagtaggataagggtggctggctctgccctgtccagggcacggctgctgccttggcg
accatgggaagcagcccccagcctgtcctcttcacaccaccatttcacccgcagcccctg
tcccggccgactcgcccctttcatttcatctgcgtccttgtcttcccctctctcccccag
GGAAAGCGTCGAGAAGAGACACTCCAGCCACCCTTCACCAGCACCTGTCCTCCCGGTGAA
TGCCCTGGGACATACCCGCAGCTCCACTGAACAGATCCGGGCTCATCTGAACACTGAGGC
TCGGGAGAAGGACAAACCCAAAGAGAGGGAGAGAGACCACTCGGAATCCCGCAAGGACCT
GGCCGCCGACGAGCACAAGGCGAAAGAGGGCCACCTGCCCGAGAAGGACGGGCACGGCCA
CGAGGGGCGCGCCGCGGGCGAAGAGGCCAAGCAGCTGGCCCGGGTGCCGTCTCCCTACGT
GCGGACCCCGGTGGTGGAGAGTGCCAGGCCCAACAGCACCTCGAGCCGGGAGGCCGAGCC
GCGCAAGGGTGAGCCGGCCTACGAGAACCCCAAGAAGAGCTCCGAGGTCAAGGTGAAGGA
GGAGCGGAAGGAAGACCATGACCTGCCTCCAGAGGCCCCGCAGACCCACCGGGCCTCGGA
GCCGCCGCCTCCCAACTCCTCGTCCAGCGTGCACCCGGGGCCCCTGGCCTCGATGCCCAT
GACGGTGGGGGTGACGGGCATTCACCCCATGAACAGCATCAGCAGCCTGGACAGGACTCG
CATGATGACCCCCTTCATGGGCATCAGCCCCCTCCCGGGCGGAGAGCGCTTCCCGTACCC
TTCTTTCCACTGGGACCCCATCCGGGACCCCTTGAGGGATCCTTACCGAGAACTTGACAT
TCACCGGAGAGACCCGCTGGGCAGGGACTTCCTGCTAAGGAACGACCCGCTCCACCGGCT
CTCGACTCCCCGGCTGTACGAAGCCGACCGCTCCTTCAGGGACCGGGAGCCTCACGACTA
CAGCCACCACCACCACCACCACCACCACCCGCTGTCTGTGGACCCTCGGCGGGAGCACGA
GCGGGGAGGCCACCTGGACGAGCGGGAGCGCTTGCACATGCTCAGAGAAGACTACGAGCA
CACGCGGCTCCACTCCGTGCACCCCGCCTCCCTCGACGGACACCTCCCCCACCCCAGCCT
CATCACCCCGGGACTCCCCAGCATGCACTATCCCCGCATCAGCCCCACCGCGGGCAACCA
GAACGGACTCCTCAACAAGACCCCTCCGACAGCAGCGCTGAGCGCACCTCCCCCGCTCAT
CTCCACGCTGGGGGGCCGCCCGGTCTCTCCCAGAAGGACGACTCCTCTGTCCGCAGAGAT
AAGGGAGAGGCCCCCTTCCCACACGCTGAAGGATATCGAGGCCCGATAAGCCGAGAACAG
GAGCAAGAACGAGGAAGAAGAAACCCTAGGCAGACACCAGGCCAGGCTTGAGAGACAGAA
CTCCTGCATGGCTCACACAGACTGGGGGGGAAAGCCCCACCCCTTCCCCTTGTAAAAAAT
GTATAGACTCAGTGCACATTTTGAAATGTTTTGTATATTATATGTTGAGATTTTTCAGAT
CTTTTAGCCCAGTCATATGTTTTCACGTCTCCTACTTTTTGTTTCTCGTATAAAACTTTT
TGATTTGAACCAAAACAGTGAAGATGACAACACACACCAATTGGATGATAATTGTAGCGG
GGGCGGTGGGGGGGAGAAGTCCACGCCATCCATCATGCAAAATTCTTTCAGATGAGGTGG
GAAGGCCGTGTACATAGTTATGTAAAAAGAGATTGCTTCATGAGCTAATGGTTCATATAT
GCAAAAGGGTAAGATGAAAGCTTTACTTTGTACAAATGTAAATAGATAAAGTAACATAAT
ACATTAATACTTCTTAAAATGTGCTATTTGCAAACTTACTTAATATCAGTGAACACAGTC
GGCTAAAGCTGTGTTCCCATATATTGTTATAGACAGCTAAACCCTTCAACTATGCAATGA
ATGTTCGGGCTTTTCACAAAAGCCCGCCTAACTCAAAGGAGCCTTTTCAAATCCATTTAC
AGCATACTTAAGGTCATATTTTCCCTGAACAAGCGCTTACGTGATATGACTCTGTTTTCC
TTGCTTGTTTTTTTTCAAACGGAGAAACATCCTGTTTTGCAAATTGGACCCCAGGCTGGA
ACTTAGCATCTGAAGTTGCCGCTTGTGGGCTCTGGGGGAAAGTGTAGCCCCGGAGAGGTA
ACTGAGGACATGAGCAACCAGTGCCAGGGAGGGTGGGATTTGCCAGATGCCAAAATCAGG
GGACGGGTGGTGGTGTCTGTCAGACACACACAGGTCGCCAGTGACTTCACACACACCTCA
TGTGAGAACCATGCCTTTTTTAGTGTGTCCTATTTCATACCTGTACACACTTCCTCGTTT
TGTAATGAGATTTACTTACACCCAAACAGATCCTGAAAGAAAGCTTCAAGTTTTCTCAGA
TGATGGATATGTTTTCACTGTATTCAATAACTGACGGATGTAAGGTGCACGTTTCCTGAT
GTGACGCACTGTATTCCAGCTGGTGATCAAGTCTGGGAACAGCCGTAACAGGTCAACCTT
GTGGAGCCATCGCGAGTTAGAGGGTGAAAGATGGCAGAAAAAAAAGTCTTGTGTGTGAGT
GTGTTTTTTGAGTTTGCATCAATCTTAATGTCTCTTCATAATACTTTTATAATACATTAA
GCCTCTTGTCTACATATTTGGAGAGAATATGACTTTACTAGCAGAGAAATACAATATATC
TTGTCTACTGGACTGTAAAATATATGTATGAAATAAAATTAGTTCCATTTGGTCTTCTAG
TATATTAAAGTGCTATCTGACGTTGTTATCCTGTTTTTGCAAAAAAAAAAAAAAAAAAAA
GTTAACTACAGACCATTGTTTCTAATAAGCAGAGAGATCTATTTTAGTAGTAAACTGAAG
GTTTAGTTGTGAGCTTCAGATTTTGTGAACTCCAGATGTTGTGCGGTGTTTTTTTTTTTT
TTTAAGACAACAACTAAAAAAATGCAAGGAATATGTACACTGGAACTGTAGTGGTAGCTT
TCAGTATTGTAAAGAGATTGTTCTATACGGACCTTTTTGCTGTTTATCCTGTATGTAATA
AAGTCCTTTCTAGATCCTATGTGAAAAGAAAAGTGAAGCAACTGAATCTTCAGCATGTTC
TCATCGGCGGAGCCTTCTTGTGTAATGTAAACTGTGCCATGTTATTAAAAAATGTGAACT

aagcttccagctgcttgtttgtgtgaggtgaccatcattaccttagggaagaagccatac
ctgtacaagaccgggctcttgaaaagaaacacctcgaacccagcccgtgtaagaacagaa
ggctcacctgcagtggctgaccaccctacccaactcggttagtgtctcaccaatttgtta