Gene ARHGEF5 Variant 1
DNA : 14.28 KbNT_079596
mRNA : 2217 bp NM_005435
CDS : 1560 bp NP_005426
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  60 bp
gtggctcgggacgtcactggtactgatctctttcacgctctctgctttgccactttcttc
cctcccagtttcccaataaagcccattttcccttctggacccctgcatctcctgctctag
atcttctttggctctctctatccctctgaaatctcagttatcttccccatttccactttt
AGATTCAAGAGGTCCAGCCGTGGAGAAACATCCGGGACCCTCAGACACTGTTGTTTTTCG

gtaagtcaccctctcccctaacagccacactgtactctcttcacttgggatactgagagt
cccctagtgaggatttcagttgataagggttctgagaccccgaatggctcattcctgttt
cttcttggtgtaaggaggagaagagagagatgccgggatgccagcttagggagattgtct
EXON 2  65 bp
ccacaaaagctccatgttagcccaagtgggtcaagttgcaactctgtgcctctccggggg
atttggtcttgacatcccagcacacatcccagaggctagagactttgtcccccacagtca
cctggggtgctctgtgtctaatggccagtaggtaccccagagcccttctttactccacag
GGAGAAAAAACCAAAGGAGGTGATGGGAGGCTTTTCAAGACGCTGCTCCAAACTCATCAA
CTCCT
gtgagtaccttgaagtggaactatagacccaggtgggcattctgcccagcactggagagg
ggcttgtggatgtcagcagtggggtggggatgtccctagcgagaaggcattgcagaagat
ctgtttccctgcctccgctcaccgtcccttcttcctgcttctcttccttcccatgcttct
EXON 3  254 bp
gaagtggaactatagacccaggtgggcattctgcccagcactggagaggggcttgtggat
gtcagcagtggggtggggatgtccctagcgagaaggcattgcagaagatctgtttccctg
cctccgctcaccgtcccttcttcctgcttctcttccttcccatgcttctttgccctgcag
CCCAGCTGCTTTACCAGGAGTATAGTGATGTTGTCCTGAATAAGGAGATCCAGAGCCAGC
AGCGGCTGGAGAGCCTGTCCGAGACACCCGGGCCTAGCTCTCCGCGGCAGCCTCGGAAGG
CCCTGGTCTCCTCCGAGTCGTACCTGCAGCGGCTCTCCATGGCCTCCAGCGGCTCCCTCT
GGCAGGAAATCCCCGTGGTGCGCAACAGCACCGTGCTGCTCTCCATGACCCATGAAGACC
AAAAGCTGCAAGAG
gtactgggcaggccacggtggggagggggctacagaaaagatgacaaggtcttgtttgct
agcatccttctctcctgctcaccactgccaccaagagtcggctgtccccaccacacaggc
gcgtgtacatgccacagctgtgggtcatgtccattctgaagaagttgaattgttttctgg
EXON 4  161 bp
agattaaatcctactcaaatgctcttcccctccccgcagatcaacttaggttctggtgtg
actgtgaaccataaaaggatcttgctcaccgctctatccccaaaacattacacagtggct
ggcatattccagggggtaaataaaatccttaattaatcttcctcatctccaacctcctag
GTCAAATTTGAGCTGATTGTGTCAGAGGCCTCCTACCTGCGCAGTCTAAACATAGCTGTG
GATCATTTCCAACTTTCAACTTCACTCCGGGCCACACTTTCCAACCAGGAGCACCAATGG
CTCTTCTCTCGTTTACAGGATGTGCGAGACGTCAGCGCCAC
gtgagactccccttctcctaaataccactcactcagcctcactgttgttaggctttaaat
gttccattatttttttcccctcttagaaaccctttcattttcacagttatgggaagaaat
tgggcctcagtttcttccatgattcccgatggttataggaagaagaatggcaagaagagg
EXON 5  153 bp
tcaaactcaggacagttttggagcgaattctagtgcatagcaaggagcacagagcagaga
gtcaatagaagttattggctaatggagtgaagaagtcaccagctcagtgtacaccagggg
ccagtcagctgtttagctgaggtccagaagtctcatgagactcgtttaaatcctgtacag
GTTCCTTTCAGACCTGGAAGAGAACTTTGAGAACAATATCTTCTCCTTCCAAGTATGTGA
CGTAGTCCTGAACCACGCCCCAGACTTCCGCCGGGTCTACCTGCCTTATGTCACCAACCA
GACCTATCAGGAACGCACCTTCCAGAGCCTGAT
gtgagactcatcccccatttaatccccatgtaggccctgaggtgaccatgcaccagtccc
cagcccagagggctatcccaagagcacactttccccattccgccctctgtattggttacc
ccagcatcacatctgagcgccctgtacatcagctcccaccgctctttcccagcccacaga
EXON 6  130 bp
tttccccattccgccctctgtattggttaccccagcatcacatctgagcgccctgtacat
cagctcccaccgctctttcccagcccacagatactccactgacctcccttccccgcacct
tcactgcatcccccattgctccccatatcccccctcccctaaggctcactctccgtgcag
GAATAGCAACAGCAATTTCCGGGAGGTCTTGGAGAAGCTGGAGAGCGACCCCGTCTGCCA
GCGCCTTTCCCTCAAGTCCTTTCTGATTCTGCCCTTCCAACGCATCACCCGCCTCAAACT
GCTGCTCCAG
gtagggcagatgctaccttgatcctctccccttaactcaaagggatgccctcaggaagac
ccacaacaaaggaccaaccattcttctgccaggtgtccacatcctgtctccctgctgccc
actgcctgcttgcttggaaatatttgctgctaaaatgtggtccctgggcttctccattca
EXON 7  75 bp
caaccattcttctgccaggtgtccacatcctgtctccctgctgcccactgcctgcttgct
tggaaatatttgctgctaaaatgtggtccctgggcttctccattcaccagcccccaatca
tttcttcctgtttcccatttcttcctcccatctcactcctgcctactgtctgttcaatag
AACATTCTGAAGAGAACACAGCCTGGCTCCTCGGAGGAGGCAGAGGCCACGAAGGCACAC
CACGCCCTGGAGCAG
gtaggcagccaccacctccactctgaccctctgtgtgttcttctcagagaggtctttccc
acctaggcccatgactccagggagcatgggaggtgggaccctgttgggagagctcagcca
cctccctgcatccgccaaacttccaaacatacacaccccacggccacctctcccacgccg
EXON 8  90 bp
atgttctgccaagtcatacaaagttgcctaggacttgtgcttgatactgcctgcccaatt
ccagcctgggaaaaatgactgaggctgtcataacctatttccagattgcttgcaagggac
tcaaaggtcaaagcctctaacacagtgcccttcccctttcctcactctctgcacccctag
CTGATCCGGGACTGCAATAACAATGTCCAGAGTATGCGACGGACAGAGGAGCTAATCTAC
CTGAGCCAGAAGATTGAGTTTGAGTGCAAA
gtgagtcggtcccatgcaccccatccctgcccatgaactcccttaacatgtcctgcagat
caccccctaacctggaaccaccttgctcacattatccccagcccctcccctcatttctgc
ccaccttctattctgtcctatttctgggaggcctacttgggtctccaagacatactgcta
EXON 9  158 bp
gggttcagagagaaagagaatctaagtgatgggttatgagccagaaggcagatgtggaag
agatgcttgttcaagtggaacttgcatggaagtggcatggggaggagggtgggactggga
gcaaacctcatgcttctcccatctgtgacactgccttctctctcttcctctgccctgtag
ATATTCCCGCTCATTTCTCAGTCACGCTGGCTGGTGAAAAGTGGGGAGCTGACAGCCTTG
GAGTTCAGTGCTTCCCCAGGGCTACGAAGGAAGCTGAACACGCGTCCAGTCCACCTGCAC
CTCTTCAATGACTGTCTGCTGCTGTCTCGGCCCCGAGA
gtcagtgactggagtggcaggccagggcacaagaggggaaggggatgaggaaagaggggg
gtctgaaagggagagagaagggtcatgttcctagaagagcccttctcaatggcttaaccc
atagagcccaggtcatagcctagagaagagaaaaacaagcccaaagcaaaaaggggatcc
EXON 10  162 bp
ccagactaggacaaatccctgaggaccctggagctaccatcttgggagcaagttaggacc
atcttatggtttttgtgggaatttgcaggctgtagatgtagggatttcgaacccaaggtt
atgagggtaggtgaagtatggaaactctagaatcaggttgaaaagatttgtattttgcag
GGGTAGCCGATTCCTGGTATTTGACCATGCTCCCTTCTCCTCCATTCGGGGGGAAAAGTG
TGAAATGAAGCTACATGGACCTCACAAAAACCTGTTCCGACTCTTTCTGCGGCAGAACAC
TCAGGGCGCCCAGGCCGAGTTCCTCTTCCGCACGGAGACTCA
gtgagatggggctgggcagaggagctgggggtgggggaagatgggcagccgagaaaagaa
gtgagaccaaggcagaaaatgtgtccagaagacagccacagcctcatttagcccattctg
gactggggaccaccatagagaaattcagactcctaaaactaatggataacttgcaggaga
EXON 11  71 bp
agacacattcacatatagttcaagattgtgtcatgtttccaaccaaaaagagtcctatat
agtgtttgatagaagtcatggaactagataagtccttcccacagtcttttgccatcccca
tccttggccctcctcctacacccccacaattgatgctatgaccctgctttgttttctcag
AAGTGAAAAGCTTCGGTGGATCTCAGCCTTGGCCATGCCAAGAGAGGAGTTGGACCTTCT
GGAGTGTTACA
gtgagtgagggtctaagagggagagaaaagaaagcagggtcagatgtcacctttggatac
aggagtttaaagggctgggtgggaactctaggctttcatttattgatattccgtaaaatg
tcagggtggaagattggcctctagagcttaaaaacctgaaatatatcgcctaaaactgct
EXON 12  105 bp
catttctggtatgtctatttctttattaaccattttcaaatttcctcttttgtctgtgac
tttcaacagcccaaatctgtctctatctcaagtcctcccacgccacccccctccaagtcc
ctgtctgtgttccaatcccctgcctctcctaacctctcttcacactcttctcttccaaag
ACTCCCCCCAGGTACAGTGCCTTCGAGCCTACAAGCCCCGAGAGAATGATGAATTGGCAC
TGGAGAAAGCCGACGTGGTGATGGTGACTCAGCAGAGCAGTGACG
gtaagcgggagcatgcgtgagcagcaggccaggcactgcaggcagggcagtgctgggagt
gtgttcacttcctgcagctgccatgacaaagtaccatggactgggtggcttatggcaaca
gaaatgcattctctcacagttctggaggcaagaagtcccaaatcaaggtgtgggcagagc
EXON 13  733 bp
cagctgtagacttggccacacccagggccgccatgttaggacacttggaggctgggttta
tgctggaggctccccagttcactcagcctgaggattcagaaaagtctccaggaaggtgat
ccagagaagctatcgtgagcctttcccaggtaattcttcccactcaccctgtgcccacag
GCTGGCTGGAGGGCGTGAGGCTCTCAGACGGGGAGCGAGGCTGGTTTCCTGTGCAGCAGG
TGGAGTTCATTTCCAACCCAGAGGTCCGTGCACAGAACCTGAAGGAAGCTCATCGAGTCA
AGACTGCCAAACTACAGCTGGTGGAACAGCAAGCCTAAGTCTTCTCTGAGAGGAGTTTCG
TGAGCTGAAGAACAAGCTGCTCATGGCAAGGGCTGGCCCCAGAACCCTGCAAGAGAGGCC
TTCTGTGGATGGAGAACTAGGCCTTCTCAAAGCTCAAGGACAAAATCCAGCTAACCCAGT
CCCTCGGCCCAGGCCTCCTTTCGTGCTTTGTGCTTGGTGGGGGGGATTTCGAGGGACTTT
GCACTGGACTCTGGGAACCTTTCATCATTAAAAAAAGGGGGACCATTGGGGCCTGAGCCA
AGGAACTTTCCTTCTACTGCCTTATAGTGCTTAAACATTCTCCGCCTCCAGGGTGCAGAT
TCAGAGCTGGCCAGAGTTTCAGTGATAGCCGTATGTTAAACAGAATCTCACCTCAGTCTC
CTGGAGGGAGATGTTTAAGAGGGGTTAACACATCAGATGGGAGGGTCAGCCCGGTGACCT
CTAAGGTATCTTCTAACCTAGAAACTCACCATAATTATGGTGCAAGGTCAGTGTGTCTCT
GAGATCTATGTCTGTTGGTGGCAATGTGAGGGTGATACTCTCTCACTCTAATAAACTTGG
CACTTCTCCGAGT
attttcttctcaaactcctcagcactgaaaaaggttcaaaacatggaatcccgagagttc
ctgcctgttgggtttaggtgtcataaaagtctaaggtggtgcataggtgatggcagttcc
tgactcctgctttctgacccctgagagtttggacagattttctgcttgttacagcttcaa