Gene ADCY1 Variant 1
DNA : 148.70 KbNT_079592
mRNA : 12500 bp NM_021116
CDS : 3360 bp NP_066939
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  661 bp
gtgcgcaggcgcggcgggcgggaggggacgcgctccgggcgcgcgcgcggggcagccggc
gccccaactccgcccgccccgcgccccgcgccccggcgcctcgccgcccgccgcccgccc
gccccggcgccgccgcccgcgccccggcgccccgggccggcgaggggcgcgcccgcggcc
GCGGCCGCTGCATGGCGCTGAGATGGCGGGGGCGCCGCGCGGCGGAGGCGGCGGCGGAGG
CGGCGCGGGCGAGCCCGGGGGCGCCGAGCGGGCGGCCGGGACAAGCCGCCGGCGCGGGCT
CCGGGCGTGCGACGAGGAGTTCGCTTGCCCAGAGCTGGAGGCGCTGTTCCGCGGCTACAC
GCTGCGGCTGGAGCAGGCGGCCACGCTGAAGGCGCTGGCCGTTCTCAGCCTGCTGGCGGG
CGCGCTGGCGCTGGCCGAGCTGCTGGGCGCGCCGGGGCCCGCGCCCGGCCTGGCCAAGGG
CTCACACCCGGTGCACTGCGTCCTCTTCCTGGCGCTGCTCGTGGTAACCAACGTCCGGTC
CCTGCAGGTGCCCCAGCTGCAGCAGGTCGGCCAGCTGGCGCTGCTCTTCAGCCTCACCTT
CGCGCTGCTCTGCTGTCCTTTCGCGCTGGGCGGCCCCGCCCGGGGTTCCGCCGGGGCCGC
TGGGGGGCCAGCGACCGCCGAACAAGGGGTTTGGCAGCTCCTTTTGGTCACCTTCGTGTC
CTATGCCTTGCTGCCCGTGCGCAGCCTGCTGGCCATAGGCTTTGGGCTCGTGGTGGCTGC
GTCGCACTTGCTGGTCACAGCCACCTTGGTCCCCGCCAAGCGCCCACGTCTCTGGAGGAC
G
gtaagtgcagccgcgcacccctcatctggtctcggacacacttgctgggacgatgctggg
aatgcccggagtcgggcgcgctttttcctatgcggcgggtggggacactgaggctccgag
tgggggtgtgttcaaggtcactcctacgagttggggacgcagtcggggctggcaccctcc
EXON 2  150 bp
ggacagggtgaggacgagctcctgcccggctgactccctgtgtccctggccctgcgctgt
gggtttggcccgggcggcgtggcttttggagagctcttgctatgctctccgggcggccta
ggccctctttgtgtgtgtgggatgtcaggctccacatgttgcctccttctctccctgcag
CTCGGTGCCAATGCCTTGCTCTTCGTCGGTGTGAACATGTATGGGGTCTTTGTGCGGATT
CTGACTGAGCGTTCACAGAGGAAGGCGTTCCTGCAGGCCCGGAGCTGCATTGAGGACCGA
CTGAGGCTGGAGGATGAGAACGAGAAGCAG
gtcagtggcttgggccagtcagcctagaggggttggctgtggggctggggaggtggaaga
agctggcttcctgagcctcagtttaccccgtggtgacatgggccacaattcccattggta
catgttggtatttgaggctgtggaggagatgccctgaggttttatagttagcaaatggac
EXON 3  119 bp
gaggctgtgccagccctggctagtgctcctggagggagttgcttgttcagtggcagtcca
gccctggacgtgggcctacccaggctcaggggcccggcgcccttactggggagggtgagg
tgaggaggagtggagggagggggccctgctgtctaacccgggcccttctcttctgtccag
GAGCGGCTCCTCATGAGCCTCCTGCCCCGGAACGTTGCCATGGAGATGAAGGAGGACTTC
CTGAAGCCCCCTGAGAGGATTTTCCACAAGATTTACATCCAGAGGCACGACAATGTGAG
gtagggctggtgctgacccggcacagcggggagcctgggaagctgaggtgtggagataat
ggtgaaggtggggaggtgatgacagaagtggggaagggatggatggaggtggggaaagaa
tgggggtgtggaggtaatggtgaaggtggggaagtgatgatggaagtgagaaggtgatag
EXON 4  112 bp
agcctcagtcttctcacctgtatgatgggaaccaggaagccttcatttctggtctgcatt
gaggaataaatggggtgattgattctacagtgatttggagatgtaaacatctgtacatct
ctagggattatttcctgagtgactgggagaagggcagcctggcacccctttctcttgcag
CATCCTGTTTGCTGACATCGTGGGTTTCACGGGCTTGGCATCCCAGTGCACAGCCCAGGA
GCTGGTGAAACTCCTCAATGAGCTCTTCGGCAAGTTCGATGAATTAGCCACG
gtaagtgcagcgtttttctttgttcgaattaaattagaattgcttctggagtgacgataa
gccaggtggattccctgtatttggaccatgaactagactgattgctaagcatttcttcca
gcaaggttataaatcacctgttgtttttagcctcactgttcattgattcctttccttgaa
EXON 5  128 bp
agccctcaagactgtgctgaccacgcaagggtgtggcctgggcgggaaggtggtggccca
ggtgcagcatgtcttgccagcgctctgtggccaccagtgtctagaggtggtggagccagc
agtggcgctcacagcctctgtagcgctgtctcttaccatgtgccttgcccttccctgaag
GAGAACCACTGTCGCCGCATCAAGATTCTCGGGGACTGCTACTACTGCGTGTCGGGCCTC
ACCCAGCCCAAGACTGACCATGCCCACTGCTGTGTGGAGATGGGACTCGACATGATTGAT
ACCATCAC
gtaagtaccccgtggggctgagaggagtggcctggggcatctacacattgaaatcctaga
agctgagccaccttctgccccatgtgggctcccctctcagggtctcgctttgtcctgatg
ggtctgtctgaggctgcagagaatgatgccagcattaggaggatgctgggttcaggaaag
EXON 6  159 bp
aggtgggcaggaaggctccatgtccactgactatgccaggagacctccacgctcaggcca
catgcagcaaggacaagacccagtttccctggtgctcacagcctagcagtgcagaccaag
gtggccccctgggaggatacaaggtgggcgccagccccacgctctgtgtctgtgttgcag
ATCTGTGGCTGAAGCCACCGAGGTGGATCTGAACATGCGTGTGGGTCTGCACACGGGCAG
GGTCCTCTGTGGTGTCCTGGGCTTGCGCAAGTGGCAGTACGACGTGTGGTCCAATGATGT
GACCTTGGCCAATGTCATGGAAGCCGCTGGCCTGCCAGG
gtaagtcggggatggggtggggaggggagggaggtgggtgatggctgtgcacccctgggc
taaatccttgcttcaggttctgggctgtgctcttgagggcacttgtgtgagtgctcctgg
aggacctgcctgtcccagccgcacctgccaaccagactccctgtggtgggcgtcccaccc
EXON 7  142 bp
atctgcctgggccctccctcctggcatggacggacttgcatgggagcatgaatactcccc
gtggagcctgccctggtgtggggaagcctctgtctgtgccccttcccctctggtaaggcc
ctgcagactctgacagcagtggttccccactcatctggcctctgcctcctccttttgtag
GAAGGTTCATATCACAAAGACGACCCTAGCGTGCTTGAATGGGGACTACGAGGTAGAACC
GGGTTACGGACATGAGAGGAACAGTTTCTTGAAAACTCATAACATCGAAACCTTTTTTAT
TGTGCCATCCCATCGCCGAAAG
gtaggcaccagagcccccctcatttggttgatccttagcttcttggcctgtgcagagctt
tacagatgtgactcctcctgcttcctctccaagcactgcttctctgggctgtgaacttgc
taagatggggagagttgtccccactgacaccgtcctgagccttgtctcttactggtgtgg
EXON 8  156 bp
tggttttgtttgctgctctattctgggcacgttccccaatgcctggcttgaagtaggcgc
tgagcaaatgaatcccagtgccctggggtggctgtgtttgtcaggatggcattcccagtc
cgagaggcacaatgtgtctcattcacagcatttctccttgccccttgtgtgtttggacag
ATATTTCCAGGCCTGATTCTCTCAGATATAAAACCGGCCAAAAGGATGAAGTTCAAGACT
GTCTGCTACCTGCTGGTGCAGCTCATGCACTGCCGGAAAATGTTCAAGGCCGAGATCCCC
TTCTCCAATGTCATGACCTGCGAGGACGATGACAAG
gtaggagcagccagggagcctgccatgctggagctgccagggactgatctctgtcctgcc
ctcccaatatggcccccgtgccatttggctagatcagaattccctgttcacatgtggata
atcttgtaaatgctgctcagagctgagctactttttatttcctgcaaaagtcattatagt
EXON 9  195 bp
gctgctgagatgactcacctgccatctcaccaccagcagggcagagtcatgattattaaa
tgtcagattcccaaacccgaccccaccctgcagcggatctggctggagggagagtacagg
tgcttttcttcaataagtggagaatttgatgatactcctttatttccatgatggctccag
CGGAGGGCATTAAGAACAGCCTCGGAAAAACTCAGAAACCGCTCATCTTTTTCTACCAAC
GTTGTCTACACCACCCCGGGCACTCGCGTCAACAGGTACATCAGCCGCCTCTTAGAAGCC
CGCCAGACAGAGCTGGAGATGGCAGACCTGAACTTCTTTACCCTGAAGTACAAACATGTC
GAACGGGAGCAAAAG
gtaagcaactctggttttcggcttccctggtgctgcttgcgaaggcgctgcctggctgga
ggaagccctcagccctgatggattgacttctctcttacacagtaccaccagcttcaggac
gagtatttcaccagcgccgttgtcctcaccctcatcctggctgccttatttggccttgtc
EXON 10  98 bp
gcccgccagacagagctggagatggcagacctgaacttctttaccctgaagtacaaacat
gtcgaacgggagcaaaaggtaagcaactctggttttcggcttccctggtgctgcttgcga
aggcgctgcctggctggaggaagccctcagccctgatggattgacttctctcttacacag
TACCACCAGCTTCAGGACGAGTATTTCACCAGCGCCGTTGTCCTCACCCTCATCCTGGCT
GCCTTATTTGGCCTTGTCTACCTTCTAATATTCCCACA
gtgagtatttctatcaacgaggtgaggaactcaccaagaagtcccggtttctggggttcg
tggttgtgtttctggggttcatggttgtgtttctgttgtatgctcaagcttcgtctccca
cagttattgtcccaatgtgcccaacatggctgacattagccagccatcatttcctcattt
EXON 11  85 bp
aaaaatagaaccagccatgtcagttcccagagacctgagtggcaggcatccaggttaacg
atgctgcttcctcctgagagcacaggggatgtggagggaggggccaattctcagccatct
cttgggtccgcctctcctaatccccacctatcagtgactctcatgttttctgtcccccag
GAGTGTGGTCGTCCTGCTCCTGCTAGTATTCTGCATCTGCTTCCTGGTGGCCTGTGTCCT
GTACCTGCACATCACCCGGGTCCAG
gtatgtgggtggcctgtgtcctgtacctgcatatcacctggttcatgtatgtgagtggcc
tgtatcctgcacctgcatatcacctggtccaggtatgagggtggcctgtgtcctatacct
gcatatcaccttgttcaggtatgtgggtggcctgtgtcctgtacctgcatatcacctggt
EXON 12  90 bp
tttcacctgggagaataaacaaatgaaaaaagccaagagacatgtgaggagggtgaaaaa
cggatgtggacctagcagcttgcaggtcatctgcacattccactataggaagtattaact
gtgcacgtgaatcaccttggtaatcagagggtattttctaaattaacatttcttattcag
TGTTTTCCAGGGTGCCTGACGATTCAGATTCGCACTGTCCTGTGTATTTTCATAGTGGTC
TTAATCTACTCAGTAGCCCAAGGTTGTGTG
gtgagcatctccagcttgtggcatgcgctggggcgggagagggcatggcatggaggacca
gcccagaagccaggacccagggctgcagagacagggaggtcatcagagacgtcagtaaca
ggcatggggccccaaggagccagggaacaagagactttacttagcagaggaaaatgcaaa
EXON 13  254 bp
agtggggagccttgaagtgctgtgagttgccatgaggtctgtggcttggtgtgatagcac
tgggggtgggtcagagcaaaaccttgggagacctgcttgaagagggacacctgagcatgc
ttaggggctgcaggtcttcacctgccctttgctaagcccctgtgacccctcccttcccag
GTGGGCTGCCTGCCTTGGGCCTGGAGCTCCAAGCCCAACAGTTCCCTGGTGGTCCTTTCG
TCTGGGGGCCAGCGCACAGCCCTGCCCACCCTGCCCTGCGAGTCTACACACCATGCCCTG
CTCTGCTGCCTGGTGGGCACCCTCCCGCTAGCCATATTTTTCCGGGTGTCCTCCTTGCCA
AAAATGATCCTGCTCTCCGGGCTCACCACGTCCTACATCCTCGTTCTGGAGCTCAGCGGA
TACACCAGGACTGG
gtaagtgtgtggctcctcaagaaaaaggcctaagcagcggtgctactgaatctgtgtata
cagatatgcactacaggcttctgagtccagaactagtcaagttgaattgtatacacaatt
tttagtttggtggctgcttctcttcaacccaagttctagcaaggtactcagaatttccct
EXON 14  127 bp
ttctagcaaggtactcagaatttccctatgataagtgattcttggccaaggtcaatccca
gcaagctgtttttgggtgtcaccacctgagggtcactctgaacagttcttgggtttggtg
gcagagtcttgccctggaagctcggcactgacttggcttttcttcctcatcttcccccag
GGGTGGTGCCGTCTCCGGGCGCAGCTACGAGCCGATTGTGGCCATCCTGCTCTTCTCCTG
TGCGCTGGCCCTGCATGCCAGGCAGGTGGACATCAGGCTGAGGCTGGACTACCTCTGGGC
CGCACAG
gcaagacgagccctttctgctttctgggggtgggggatttagaggaggaagaagtcttca
gcaagcatctgacgggggctgccacagacacccacacgccgtatggccctcggagggccc
tcctcagcagcatgcaagccaggcactgtccggggatggaggagacctatgctgggggtc
EXON 15  117 bp
tcttccctacccagtaacatggatctagtcttgcatctagtggggaggagggacaggagc
gtggatgtagaccatcagcacacctggagtccagtttggatgattagaaggaagtgtgcg
gtgggaacaagtgaaggcagcgtgagtggatgggactaatggaggctcatgataccccag
GCAGAGGAGGAGCGAGAGGACATGGAGAAGGTGAAGCTGGACAACAGGCGCATCCTCTTC
AACCTCCTGCCGGCCCACGTCGCCCAGCACTTCCTCATGTCCAACCCTCGGAACATG
gtgagcacccagcctgctcctggccagcactagcccgacactgctctggccaccccactt
ggcgctcacctggctgacccttcctgacccatcctttgaacttccaggacctctactacc
agtcctactcccaggtgggcgtcatgtttgcctccatccccaacttcaatgacttctaca
EXON 16  147 bp
caggcgcatcctcttcaacctcctgccggcccacgtcgcccagcacttcctcatgtccaa
ccctcggaacatggtgagcacccagcctgctcctggccagcactagcccgacactgctct
ggccaccccacttggcgctcacctggctgacccttcctgacccatcctttgaacttccag
GACCTCTACTACCAGTCCTACTCCCAGGTGGGCGTCATGTTTGCCTCCATCCCCAACTTC
AATGACTTCTACATCGAGCTGGACGGCAACAACATGGGGGTGGAGTGTCTGCGGCTTCTC
AACGAGATCATCGCCGACTTTGACGAG
gtgaggctgtgcgtcgccatcctgaccccgcctggttgtggtggtgcatcctgttgcatg
ggcagagcgtgtctcacaatatgtcacattcttcgtagctggaatgagagaaagcaaatc
ccgggaagcacaggcattctgtctcctttgggatccagaccaaccatgacaggagagaag
EXON 17  99 bp
ctgtcctgcctcacctcttcttgccagtgtagtcctagaacttgtctgcccaaagcaaag
aagacatgttgctttcctgaatgtgtccatcggctctgctgttgctcctgggggctgacg
gctgcagcgacttttctcaaatgttatgtcatgtttaacagttttatgttttaaacaaag
CTCATGGAAAAAGACTTTTACAAGGACATAGAGAAGATCAAGACCATCGGGAGCACCTAC
ATGGCCGCTGTGGGGCTAGCGCCCACCTCGGGGACCAAG
gtgagtgcagcctggcgctgcctgcttggggactgggtccaagctctgccctaaactgct
ctgggaccctgggtagcttccacactggggtttgtttgccctctgtgttggattacagga
gcagcttgagtgctgtttttgtccgtggctggctctctccagacacaatctcctagggaa
EXON 18  115 bp
gccaataccctgcctctctcttagtctcctacctgtagaatggaatgataaatgtgccta
tagccaggcactcagagtgccttcctctgaaagtgcagctgttgggcactgcaggttggt
ccctggccccctcttgccttgcactccccagatgtaatgaccccatctgtttacacctag
GCTAAGAAGTCCATCTCCTCCCACCTGAGCACGCTGGCGGACTTTGCCATTGAGATGTTT
GACGTTCTGGATGAAATCAACTACCAGTCTTACAACGACTTTGTCCTCCGAGTTG
gtatgtggctctaaacctatcctgtccatccatgtggaacaccttcctacacccacctag
gggtgggatcagctgatgaggtaccctggtcttacaggaaggagggtggtgccacccagg
agggcatggggacctgtgtaccgagttgcccctggaagctgctggtggaaggtgaagatg
EXON 19  125 bp
ctctggtgctgtgtgtgatgcttcaggaaggagcctggtgctaggtgaccccaggaaaca
aagccctgaaaggagcagccttttctccaccaggagcagcatcaggtgcatttggtggcc
ctggtggggtgagttacacttttcccgctgatgacaggtcatgcgctggctgttttctag
GCATCAATGTTGGCCCTGTGGTGGCTGGAGTGATTGGCGCTCGCAGGCCCCAGTACGACA
TCTGGGGAAACACAGTCAACGTGGCCAGTCGGATGGATAGCACAGGGGTCCAGGGCAGAA
TCCAG
gtcagttcaccaagaaacccctaaggcatgggtgcccattcttcaggtgaggaaactgag
gcacagggggccagaattgaatccccagtctacagcccgtaagtggcagggcagaaagag
ctgcatatttcggtctgtctgctctggagggcatcctggcccgggcatcttgattttgct
EXON 20  9421 bp
agtgatttcagcaagagtaggggccctggctgccaggctgagctgggaaagccacatccc
agtgccagggttgggcagtcagggtggacagcaacagatgcaggatggagtgttttggtc
tcttcccagaggagtccccctcattgccctgaagtaacactcacttctctccatcaacag
GTGACTGAGGAAGTCCACCGGCTGCTGAGAAGGTGCCCCTACCACTTTGTGTGCCGAGGC
AAAGTCAGTGTCAAGGGCAAAGGCGAGATGTTGACATACTTTCTAGAAGGCAGGACTGAT
GGAAACGGCTCCCAAATCAGGTCCCTGGGCTTGGATCGGAAAATGTGTCCATTTGGGAGA
GCTGGCCTTCAGGGCAGACGTCCCCCCGTGTGCCCCATGCCTGGCGTCTCAGTCAGGGCT
GGGCTCCCTCCACACTCCCCAGGCCAGTACCTGCCCTCTGCAGCAGCTGGGAAGGAGGCT
TAGTGGAGCCCACGTGGGCCTCTGGGGTGCACATGGGGTGGGAATGCTCCGGGGGTGACA
CAGGCCACGGTGGCTCCAGCCAGGACCAGCCAGACCAGCAGAGCAGGGAGCCACTTGCCA
GGGTGGAGGAGGAGCATTGTCCAGGCATGGCCTGTGGCCCGAGGGCCAACCACCGAGCAG
GCACAGCACAGCAGTGACTCGGTGAGGGGAGGACACCCGACTGTGCACACTTCCAGGCCT
CCCTGGAGAGGTGTCCACTCCATCCTTCCCTCCGTGGCGTAGGGAGCACTGTTTCTTTCC
AGCAAGCCTGTTCAGGTTTGGCCAGGTCGGCATCAATGTAAGGACCTTCAGAGCATCCCA
GGGTTACAGCAAGAGCCACTGAGGTGTGGCTGGCAGAGCAACTGAGGAGCTCTGCGAGAG
TGTGCCCTCTGAGACAGCCCTGTCCGCCCCGCCCAGGTGGGACCTGACATACAGGCGGCT
CCAGCCCTGGGCAGCGGCTTCAAGAGCCAGAGTGGGAAGTCAGGCCTCTCTGGGAAGGTC
ACAAGGCCTGGGGTTGTTCACACCACAGGCACAATACAGAGCTGTCCACTCTTGAACTGG
ACGGTCTGGGGAGAATTGAGAAGCTGCCTCTCACTGCATGGATAGTGGTGGCTGCTGGCT
TTCAAGCGTGGTTTTTTGCTAAGAGCCAGAGGCAGGTCTTCTGGAGTTCTCAGGGGGGCC
CTGTGACCCCCTCTCCACAACCATGGCCAGCATCGGCTTCTTGCTGCACCTGTGCATTCT
CCACCCCTCCGCCAATGGCTTCCAGCTCCTAAAACACCTGGACATTCCCCATCCTGCACC
GGCACTGTGTTTGTTCAGAGAAAACGAAGGGTGTCATTTCTTCTTTTCCCTGTGGCATCG
TGGATCCTTTACATTTAGCAACAACAGTGTGAGGCTCCACTTCTGTTGAATATGAGCGGC
TGTCACACCCATGAGCAAGTTTCCTTGATGGAAGATGCTGTTTCTCCGGCAGAACCAACC
CTCCAGGACGAAGTTTCAGAATTGGCTGATGGTCGTGAGTGCAGGTGTCCCTGTTGTAAT
TTGCAGGGAAATTGACTGCAGGTGATAGTGTTGACGTCTGACGTCTGACAACCTCCTATG
TGCATGTCTAAATAGTCACAATGAAGATGAAAATAAGGATGATGGGGACGGGGTCCAGGA
GGGCCACTGGGAAGGCACTATCCAGAAATAGTGGACAGAGGTCTGGCATGTGGAAACCTT
GGATCTCGGTCACAGGGAGGAAGGCAGCTAGAAATGGGAGGGAAGCTTCTGGGTAGGCAC
CATAGTAGGGGAATGTCTAAAGACCCACTGCTCTGAGATGTGGTCAGAGAGGTTTCTGTG
GACTGCAGATGAGGCCTGAGCCCTGCCTATGCTCAAAGCCAGCAGGGTTGGGGGTCCGCC
TCCTCACTGCTCCTCAACAGCTGTAACCCTTTCCTGAGGGCCCCGACTTTTCAGAATAGG
AGCAGAGAGAAGCCCAGACTTCCTTCCCTGGAGTGTAGACCTGTGTGTGGGACCTGCTCC
AGGCTGATCCCTGTCCGCACAGGTGGGTGATGTCCTTGGCTGCTGCCGTCAGAGGCAGCC
CCCTGCACAGGGAGGGGCTGATCCTGCCTCAGCTGTGTGGCCATGTGGGGGCAGCAGGGG
CCTGGGCCATAGCTGGGGGAGGCCAGACCCTGAGGGCTTTGCAGGGCGGCCAGTGCAGTG
ATGCCTGGCGCTTCCAGCTGAGACAGGAGTCCGGACAGAGGTGGGCAGGGTGGATGGCTT
CGGGCAGGGAAGGCGGGTAGAGGCTGCATGTGGGGGCCCCTGTCTGCCTGTCCTTAGGGT
GTGGATTAGGCTCTGGCTTCTGTGATGGTGCAAGAGGCAGGATGGTCTCCAGACACCTTC
TTGCAGAGTGATTTTGACCAATGCCTTTCCAGCACCTTCCCCTGGTTATGACAGGGAGCT
CCCAGGCCAGGCCACATGACCCCACAGGTAGGCTGACCCCATGGACCCACTGGAGACTTT
GAGGGCAGAGCTCGGGCACCTTTCATCTTCCTTGGGTGGTCCTCATGTCGCTGTCCGCTC
ATGTTCCTGGTGTTCTGGCATCACCTTGTGCCGGTGGGGGCTGGGCTCCCGTGAGGTCCT
AGGGCAGAAGGAGGTGCTTGCAGGGCCTCTCGCTGCTACTGGGACATCCACAGGACCTAA
TGTTTATGTGGAATCTCCAGGCTGCCATCGAGGGCTCCTGAGCTCATCCTGAGGACCCAG
GGTCCATCTGAGCTGGCTGTGGGCTGAGATCCTGGCTGGGGCCCTGCTGTCAACCTCTCC
TCCAGGCCCTGCCTTGTCCCTGCTCCTGTGCTTTCCTCTCTTCAGGACAAATGGTTTGTC
CTTATGGTCCCCTTTCCACTAGGATTTTCTCATCCTCATCTGTCTATCCCAGCCGGATTT
AAAGCAGTCACTTCAGACAGGAGCCACAGGGAGCCTGTGAGGGAGTAGTGCGGTGGTGGT
GAGTGTGGCTGCCCTGGCTCCCCCAGCTCACCGTGGTGCTGTCCTTGACCCACGAGCTGT
TGAGAAGGGTGCAGAGCCCCTGGCACAGCCAACCCTGTTGCCCCCAGTGCCGCTGCCCAG
CTTCGGCCATCCAGGTGGTGGGTAGACAGAGGAGTGAACCCCAAAGGTGTCCATGCCCCA
GTTCTAAGCCCTGTGGCCAGGCTGCTGTCACACAGCAAAGGGGACTTTGCAGGTGGAATT
AGGGTTAGGGATCTAAGGATGGGAGGGGAACTTGGTTTATCTGGGTGGCTCAGTGACCCC
TTGGAATGGCTGAGGGAGGCAGGAGAGCCTGGAAAGATTCGAAGTGTCACAGAGATGGTG
CCGTCATTGCTGGCTTAAAGACAAGGGGCCAGGAGCCAACACCAGAGGCCACTCCACAAC
CCCAGCGCCAGTCAGCAAGGAAGCCGGGTGTCGCTCACACAACCAGAAGGAGCTGAGTTT
GGCAACAACCCAAGTGAGCCTGAAGCAGATTCGCCCCAGAGCCTCCAGGCGTGAGTGGAG
CCCAGTCCAGCGACACCTTGGTTTGGCCTGTGAGACTGAGAAGAGAGCCAGCCACGCCAT
GCTGTGCCTGGGGTCCACAGAGCCGGGAGGTCACACATGTACATCCTGGAAGCTGCCCAA
GGTGTGGCCACTTGTAGGGCAGTGAGAGGAAGCCGTCGCGGGGACCATGCTGCCTTCTCT
GGGCTCACGACTGTTCTGGAAAGGACCCCATGGCAGACTTGGCAAGGTCTCCACTTCAGG
GGCAAACATCTCCATCATCAGCAACTCCAAACCCCAGCCACTTCCTGGGAGTTCAGGAAC
TGTGTTTAGCCATAATGTCCCTTGGGGTTTGGTGAAAAACAACTTCCTTTTTATTTGTGG
GAAAACTGTATTATATTGCCTTATTTATTTTTAATCATGTACAATATTCATGTACAAATG
TTAGAGCCATTCGGGTAGGATTCTCTCTAAATTATTTATTGAAGAGGCTTTGTAAATAGT
GCACCAGTGACAGGTGCTGCCTGTTTACTCGTACCAAAAATGAAGACAAGCCCCACACCC
ACCTCAGCCCTTGCTTGGCCATGCTGTGGCCCTTTGGAAATGACCCTGTGTGCTCCCCTC
GCGACCCTTGCATGCCTTTCATGCCTGATGCCGTAGAGTAGAACACAGCCCCGGAATGCT
TCCAGTTGCTTGCAAGGGACCATGCCGGCCCGGGTGGTCCATGCCTGCGGGGTGTCTGTA
TCCTGCAGGAGGACGCCCCTACAGACCCAGCAACCCAAGTTGCCAGCCCGTGTTTCTCAG
ACTTTAAAGCCACCAGGGCTTCTGGAACACCTGTCATAGAAGCAATAACTCTAACTCTAT
ACTGTAGAGATGAGTCTGGTCCGAAGCAGATTAGTAATTTAGAGATAAGCCATGCATACA
AGTTTGCCCCATTCTCTGGCTTGGGGTGGTGGGAGGCGGGGAGCTGCCACTCCCAAAGCC
TCCACCCCTTCCTGAAGACCCAGCTATGAAACCGCAGTTCCTGTGGGTTGGGCTGCCCAG
GCTGGTCAGAGCTCAGCACCCCAGGTCTGGTGAGCAGACAGAGCCGGCGTTAAACCCCGA
TCAGGTCATTGTCACCACACCCTTGCTTGGATGAGGAAGGAAGGAGGCAAAGGCACCCAC
TCCATCCAAGATCCATTCCAATTGATGAGCCTCAGTACTGGCCTCACACTGACCAACGGT
GGTATGCTGCAGTTTGTTGGTTTGGTGCAGAGTCTAAAGGATAACATATCAAGGCTTACC
TGTGATAGGCCATTTTAAGGAAATGGTGGCACTCTGAAGGCTGTCCCCATTCACCTTCCA
CAATGCTGGTACCATCCTGGTAGAAGAGCCCTCTGAACAGGACACCTGTTCAGGCCTGGG
GGCCCCATGCTAGGCTTGCCTGGGTGTGAGAAGGTCGAACTGGGTGGCTTAGGCCTTCAA
ATTGAGCTTGGGGGTGTCCAAGAGAGGGGTCTTATTCGAGGAACTCACATACCCCAAATA
ACCATCAGTGCACAAATCATTCCATGCTCTTTGGCACCAGGCAGGAGATGCTGCAGGCAG
GTGTCCGTAGTTGGCAAAAATGGGCAGTAGGGGAAATGGAGTTGCTTCAACCTTTCTCAG
TCCCGGCCCTCACTGCACCCACCAAGTCAAGCAGAGCTGGGTGGGCTGAGACCAGCATCC
CAGCTGGACTGAGCCTGGGGGGAGGGGCTGGAGCCAAGGAGCCCCCCTGGGTGGGGGCAT
CAGGAGCAGGGGCAGGGCCTGAGGACTGCTCCCCCTGCATGGAGGGCAGGCCAGGATGGA
GCCCAGGGTAGACTTTGAGGAAGGCTCAGTGGGCTCAGCAGAAGGAAGGCTCTTCTCATA
GTTGTGGTTTTTCACAGATGGATTTGGGTGATCTGAGTGTGGTCAGGCCCTGCCGTTGGG
GAATGAATGCCACACGGGGTTTGTCTGTAAGCTGCAGTGTCTGTGATTCTGTGTGAACTG
ACAGCAGGGAGCTGAAGGACAGGCCCCGGCCTTGGGAGAGGACACGGGCATGGGCTGCTG
GATGCAGGGCTCCCAGGGCTGTGAAGGCAGAGGGGTCTCTGGAGGCAGACAGGGTGGGCT
GGGGGCCAGCAGCAGGGGGCAGAGCCCCAGCCAGGGCAGCTGCTTCCTGCACATAGACAT
TCCTCCTGCGCAGGGCCAAGTGCCCATGAGCACAGCCCCAGACAGACACGGTGGGGAGCT
TGGAGCCCTCCGCTCACCTAGAGGAGCCCTGGGACACGCACTGGAAAGTATTCTAGGGGC
TTCCTGCCTTATCCTTCTGTTTGTTCATACACTTAGTGAAAGCAGATCCTGTACTAGGAT
GTGAGGATATCTGTCACCTGCGTGGTCCATTCCATAAACACCAGATTCCATTTCAGTTGC
CACACATTTTGGGGCTAGACTTCCCTAAACAACATGCCATTGTGAAATAATGCATATATT
TGTATTTTTAAATTTCCCTGAAAATTTAATCTATTCTGTTCCATATGAAGTCTGTTTCAC
TACCTTAAAAAATAGATACTCCACTAGAGGCTGTGCTTAATTCAAATCCATGTGTGTGCC
TGCATTACATGTGTGAACACGTGTTTCTGTTGTGTGTGTCATGCACATCTGTGTGTTGCA
TAGCATAAGCCAAATGAAAATCATTTGTTCATGGGATTCATATGAGGAACAAAATTAAAT
TTGAATACAGTCAGATAACTGCCACGCAGGGCATTTGGGGAACCATCCCCGAATGCCCTG
ATGTGATTTCCCTCAGAAAATCCTTGTTATTAGAGGAGAAGGTCTGGGCAGGGGCAGCAG
CATCTCAGACATCAAGTCAACTTTATCATCTACTACATCAGCACTGAAGTCCAGGGGCAT
TGAGGCACTAACTAGGTTCCATTTTCTTTGGTTTGGTTACTTATTTTTTCTTTTTGGGTT
CTCGGTGTGCAGAGGCTGTAGAGAGAGCCTCAGGGCGGTGACCGCTGCAGGAATTCGGCC
CTCCAGCTCCCCTCCAGTTACCAGGAGCCGATTTGGAGGCCAGGCCTTCCCAGCTGAGTG
TCTGTCAGCTTCATTCTCTCTCAGCTGTGCAGTGGAAGAGCAACAACAGACAGGTGACCT
TCTTGGGTTGTGCTTCACAATGGACTGGGAAAAACATCTTTGAAATCAGGAAATCAGGCC
GGGCGCAGTGGCTCATGCCTGTAAGCCCAGCACTTTGGGAGGCGGAGGCGGGTGGATCCA
TTGAGGTCAGGAGCTCAAGACCAGCCTGGTCAACATGGTGAAACCCCGTCTCTACTAAAA
ATACAAAAAAAAAATTAGCTGGGCGTGTTGGCGGGAGCCTGTAGTCCCAGCTACACGGGA
GGCTAAGGTGGGAGAATTGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTGAGATTGC
ACCATTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTCTCAAAAAAAAAAAAAAAAGAA
AGAAAGAAATCAGAAAATCGACCACAGTGGTAGCCACCTGGCCTAATGCTGTGTTTTTGT
ACCTGACAGGGGTCACTCATTTTAGGCACAACTCCTTCATTCTTTGTGAAATTAGTGAGT
TTCCTTCTACCCGTCACCAGATTCAATATGTTCTATTAATACACCGATAACCACAGGGGA
AGGGCACTTGTCGCTCTCCCACCTGGTTACCACAGTCTCCATGGGTCTTTTGCCGTGACC
ACAAATAAAGGAAACACTCATCACTAGTATCTAAGTCGGGCTTTACAGTAACTATGCACC
TTCTGTGTGCTTCACCTCACTCTCTACTTCAAACAGCCCATGGAGGGAGGTATTATTATA
CTCCTTATGTTGACAGTGAAGAATCTGAGGCCCAGAGAGGTTGGGGACTTGAGTAAAGTC
ACACAGCCCTGAGAGGCAGGACCAGGGTTCCATTCCTGCTCTATCCAGTTCCAAGCCCTT
GTGTTTTCCATTATGTTTAGTGCCTCTTTGCTAACAGCAACATCTGCAAGATTTGTGTTG
GTTTTGATGGAGAACTCTAGCTCATCCACATGCTAGTGCCCAAGTGGTGGAGGGGCCACC
TCAGCAGGTGGGTTCTGAATGCAGCCAAGGCTGTCCCCGCAATGGGTGAGACTCGCTCCA
ACTGCCCGCCCTCAGAGCAGGTGCCTAAGTCCTCCCTGGCACTGGCAGGCCTTACCTCAC
ATTGCTAAATTAAAGCAATGCAATTCCTCTTGGGTAAGAGGAATTCCTCCTTCTTTACTA
ACTGATCCCCAGCAAGGAAATAAAATGTTAGGCTTTAAAAATCCCTACTTTGTCATATCA
GACTATATTCTAAAACTATATTTGAGCGAAACCTGTCATTGCGTCTAATTTCAAATATAC
AGAATCTCCTTAAGAGCTGTTGCCTTATTTTTTTGTAAAGCCTCTCTGACATCAAATGGG
GAGAAATGGTGGCACCTCCAGACACCCTGAAACTACACACCATTTCTTCCCTGCTCAGCT
TCTGCTCAGGAGTTCTGTGAGCTATGGGAAGGCCATTGGTTGTATTTGCTACTTTTACTT
TCATCTTCCTCTGCTGTAGAGCCATTTAATGTTATTGTCATATGCTGCTGGTGAGGTAAA
GGTGGGTCCGGGTGCCTTCCCAGGGGTTAGAGGATGTTCAAAGGGCCGATTTCAGCAGGA
GTTCAGAGGGCTTATGATGGATGGTGAGAGATTTGACAACCACCAGAGCACATGTGCTCT
GACCCTCTCCTGGGCATTGGTTCCTGCTGGTACCGGGCGGTTCAGACCTTCAAATAGGTT
GCTTTCAAAAGAGCTTTCAGGCACTTATTGAGAATTAATGTTTAAACAGACATAATAGCC
TAGATGAACTCCCAAGAGATCTATTAAATCTTGTGGGCTGAATAAATATCTCGTGCAGGA
CTGTGCAACAGTAGCCCAGAGCATCCTGCCTGTGGGCATCCACCTCCCAGGTGAGGGCAG
TGGGAAGCTGGCCCGACGGCAGCCAGAACTTGTTTCTCACCTCCCACCAGCAACCCCCCA
CCCAACTCTGGGCCCCAGGCACACGAAGCACAAGTCTCAGGGGACCATTCCCACATTGGG
GGATCCTGAGGGAGCCCATCACCGCCTCTTGCATACAACTGTCCACTAGGAGGCACGCCC
AGTGTGGGAGAGATGTATGGTCTTGCCTTCCACCTGTAAAAACTGCACATATGCAAGCCA
TTTGCACTCTGGAACTGCATGCCGTGAAAACTCCTAATGGTGTGGAACTTAGTTTGAATT
TGAAATCACGCCGCATGCACAAAGGGACAGGCCCAGGCCCGACCTCAGGTCATCCGCCCG
CTGGCTGCAGAGCATCCCTGGGAGCCAAGGCGAGGCCCGTGGAGCCTGAGCTTTGTGTAG
CTCGAGCTTTGTGTAGCTCGTGCACTTATTATGCACCACCTCCCTTCAGTCACCACTCCT
CTTCCTCCGCCATCCTCATTTATACTGATTGCACACCCCCCGCTCAAACAACAATGTCCT
TATTATGATGACCATCTCGTAGTGGTACATTCCATTCCTATTTAAGGTAAGCCCAAAGCC
CACTTTTGGATTTTCTCGACTGTCCGAGAAAAGTTGTGTAAGCGCCTGCGTTCTTCTGGG
TTTGGCTAGATAGGGTTGTGTCCCTCTATGGAATGGAGAGTGATGTGGGCAAGGGTGTCA
TTTTCTCGCACAATACAACTCACTGAGGATGCTTCTGTAGAAGTGAGAAACACGATGAGT
ACATTCAGAATTACAATAACTCACTCTCACTGGGTAACTTCTCATGATAGATTTGTATGA
TCAATACGGGTCTATTTTTATGTCAACTGAACACTGTAGGGTACCTTCCAGTCTTTTTCA
AGATTGTTAAATTGAGACAAGTAATTGAATAATTTGTCCTATTTTTATTTTAAAAAAAGT
GAATGGACTGAAATGTTAAATGTGAATGTACATTTCTTAATTGCAACTTTTCTACTGAGT
GTTTGCACTATACTTTCTGGAATCTTATTTAACAAAAATAAAGGGAAAAAATTGCTTGAC
T
aaactctgtggccatttcagttgaaaaataaatggttatgtggatgttttgaagacattc
ctgcctgtttcacataacttctgggggaagttttattattcaaagtattaaatactacgt
gaccccatttagactaaaccacacatgaactgttatccccccattacatactattcttct