--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (48463 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3733       4071   0    Initial    339    72        Good
gtaaatacccttgctttctaatatcaccagaaggataaggaattcatatttgaaaagtgc
tttgaactccttagtctcccaggaacactgagccaggcctccctgttcacgttgccctca
cctctgtgttggttggtcccttataggtacatgagagctacaggtggctcctccagggtg
ATGTGCGATAATGTGCCAGGCCTGGTGAGCAGCCAGCGGCAGCTGTGTCACCGACATCCA
GATGTGATGCGTGCCATTAGCCAGGGCGTGGCCGAGTGGACAGCAGAATGCCAGCACCAG
TTCCGCCAGCACCGCTGGAATTGCAACACCCTGGACAGGGATCACAGCCTTTTTGGCAGG
GTCCTACTCCGAAGTAAGTCTCCTGCCTTCACCCAGCCCTATGGCTCTCCACTCATGCAC
AGCTCCCTCACTCCATCTTCAAAGACCCTGCTTATCTTCTATTGCATTTTATTCCATCAG
AAGTTTGTTCAGTTGGGCGTCATTGTCCCTGTTCTACAG
gtgaggactagagaaatcaaggaacatgtctagaggtttgtaagaggtgaatcaaaagga
agaagtagaaccccaggctgttgtcttttcactctttgctctgtccatcactccaatatg
gcacatcctccaggttcagacttcgtctctaagagacgagagggaggagccacaagtctc

Exon  2 +       5644       5683   0   Internal     40    60    Marginal
catttatgaaatgatcatctctggatctattaagatatctacatatttgaataaaacctt
tagatcacatatcaaaggaagcaatattgaccagtgatcctaaagaaaatatatccatca
aagctggggattcatttataaaatactgtaacttaatcttgacactattattttcttcag
AGCTGTAGAATTGCTGAGATGAAGGAGGTTCGAACTAGAG
gtaacagccaggctcactcctataatcccagcactttgggagactgaggtgggcagatca
cttgaggccaggagttcgagatcagcctggccaacatggcgaaaccccatgggtgtggtg
gtacatgcccttaatcccagctacttgggaggctgaggaatgaaaatcacttgaacctgg

Exon  3 +       5998       6176   1   Terminal    179    68    Marginal
tcccagctacttgggaggctgaggaatgaaaatcacttgaacctgggaggaggaggttgc
agtgagccaacatattgccactgcactccagcctgggtgacaggactggaggaaacagaa
ctagtttaaattagtctagacctcaggtaaataagagattctaacttgtacttccttcag
ATTTTTTTCAGATGAAGCAGAATACTTTGCCACAGTACTCAGAACTTAAACCACTCATGC
TACACAATTTCTTTCCATTCTTCACAGAAGGCCAGGTTCCCTCTCAGACATTTATGCAAA
CTCTTGTGACTGTCAGTGATGATTTTGTGTTGGTTATGGGAGGGCTGAATTTGGCCTAA
agcagcttatcctggaaataatcaagaaattccaatgaagctatccaaagatttctacaa
ttagttgcttggagaaaaagttacgtcttagagttgtggacacctaaatatgctcataga
tgaataggaaaggcaaagggcaagaccatttataagaagaacataaaattaccaaaatgt

Exon  4 +       9143       9436   1   Internal    294    89        Good
gatggttcatattaaagaaagagcctgggctctagaaaagaacccttcaagaatatcagt
accttgttgtctagtggcaaaggttgtctgaaacagagcaaatattaaacaattgtcata
tgaaagttattcagaaatagtgctaccggaccacttttaagaaaagcatttttgtttcag
GTAGTCGGGAATCTGCCTTTGTTTATGCCATCTCCTCAGCTGGAGTTGTATTTGCCATCA
CCAGGGCCTGTAGCCAAGGAGAAGTAAAATCCTGTTCCTGTGATCCAAAGAAGATGGGAA
GCGCCAAGGACAGCAAAGGCATTTTTGATTGGGGTGGCTGCAGTGATAACATTGACTATG
GGATCAAATTTGCCCGCGCATTTGTGGATGCAAAGGAAAGGAAAGGAAAGGATGCCAGAG
CCCTGATGAATCTTCACAACAACAGAGCTGGCAGGAAGGTATGGAAATGCAACG
gtgctcattttgtaggctgcatggctttataaaccacttaggcagagcttatcttaaact
tccctagaattgataaaatgctgtgtagtcacaacttcctactgtcccccagccattagc
tgtttgttcggaagaataccaacaactaggttgaaatattcccacccacactccaccttc

Exon  5 +      10008      10107   1   Internal    100    52    Marginal
tgaaaacaactcatcaagcatggtttgttggcttcttctagatttagggatgccctcttt
gggaacctgacccaagtctcactcataaaagccccaccttgttgtttctggtgctggata
agtaagtggaccaggagaagacatgatcctcagagggtattctggccccttctcctctag
ACCTGACTAACTTCCTGGGCTCCAGTCAGTGTACACCCTTTAACCATCATTTGTTAAATG
AGGAAACTGAAGCCCTCAAGGTACTCAAGGTCACAAGGAA
gttagtagaaaggactagaaagttaggtttcaacacgtagtccaggggtgctttacccta
ggattaaaccatttcaatgccaatgttcagacccactgatgacccatgtcttttggtatg
gtggtatgaccagaataactagagaatttaatgctgtacttgatgcttttgtgtggaaag

Exon  6 +      12583      12713   0    Initial    131    53    Marginal
gttcctaagggaatctgtatgaaaataactcatgtttccagtcttactgcccttccatca
ctctgaaagtttctataagagtaggaatttccataagaataagaggaattccatgaaaat
actttccctaaaaggtgcctctaacttaaaaatagaaaagaacatgggacttcaaatcag
ATGCACCTTTGTTTTAATCTTACAATACCAGTGGCTTTGCTCATTGAATCTCGGTTTTTC
TCATGTATGGAAGGGCATTTTGTGGTGCTACGGGAAGACAAGTGTAAGGCAGATAGCACA
GAACCTGGCAT
gtaatagatgcttaataaaagttcctttcccttttgtgaagttaagattatttgtaactc
aggtaacagagctaggcagaagtccatccagctggaattattatttaggattcaatctga
tcactccatctatctatagagtcatcttctattcagttaacatactaataaaaccaagca

Exon  7 +      16954      17092   1   Internal    139    62    Marginal
ttctcatgttctgcaaagaagttttacaaagacactgtaagggctgcttgggctcagtct
tcagaagaactgacttaagaaaccaaaacttccttaggagaagtttgtctttataactgg
caatataattccttttagactataattagatacgcaaacactaagtgtaaaagcttatag
AACTCACTGAATCCAAGGAACATGAGCCCCAGAGACTGGCAAACCCTAATATGAAAAACA
CCAGCAGAGTGATGTCGACTTTGGTGTCAGACAGGCTTGGCTTATATCCTGCCTCCCTGG
GTTATCTCACTTACTGCCT
gtgagatctagggcaagctcctctactcctgggtgtttcaatattcttatctataaaatg
ggataataatagtatataccttacgtggtagtgtggactaaataaaatagtgaatataaa
gtgcttagcatggtttgatatatggtaagaaattaaagaatgtgatgcctcagtattata

Exon  8 +      26613      26877   0   Internal    265   100   Excellent
agtcagggcaggtggctaatgtggctaacaagtgacaagcaatgcttcaacatttcccag
tcacttgccccaggatccagcatcctgagaatcacttctggattgctgggaggtaaggag
agttggagcatgtgtcacctgctcgaacctcactgaacttgcccctgtctttttcggcag
GCTGTAAAGCGGTTCTTGAAACAAGAGTGCAAGTGCCACGGGGTGAGCGGCTCATGTACT
CTCAGGACATGCTGGCTGGCCATGGCCGACTTCAGGAAAACGGGCGATTATCTCTGGAGG
AAGTACAATGGGGCCATCCAGGTGGTCATGAACCAGGATGGCACAGGTTTCACTGTGGCT
AACGAGAGGTTTAAGAAGCCAACGAAAAATGACCTCGTGTATTTTGAGAATTCTCCAGAC
TACTGTATCAGGGACCGAGAGGCAG
gtaagttcaaaagactttctttatagtacctaattctttcaacaattgatactccacaat
ttaaatgaggttctgtattttcagcctgctctctttaggttcaaagctcacgatccttat
cattcttattgaaactgtacagggctgggcgcggtggctcatgcctgtaatcccagcact

Exon  9 +      31400      31467   1   Terminal     68    51    Marginal
ttgttttatcaattaggtttgtgcaactgatgcagtctacaggtctggtctacttttttc
caaaggaagtggctcttcagaaacctattgaaccagcatcttagggagctgttcccgaaa
ttatataagtttctctgtttttcatcattttaattttttttttattgctctgttgcccag
ACTGCAGTAGCACCATCGTGGCTTACCGCAGGCTCCGACTCCTGAGCTCAAGTGATCCTC
TCACCTGA
gcttcccaagtggctgagtccactggcactgcctctgcaaacttttcaaacttaaacacc
tcaaagtttgaaaaatcagtgatttaggcagtgtatgattcctaattttccctaattatt
aggcaagaagaaattcagggagacatgagtttcatatatatatgttttttcagtacctga

Exon 10 +      39333      39631   1   Terminal    299    53    Marginal
cataatttggagacatgcatcctggcattacaaacaaattattctcatttctcttaaagg
ttacaggcatccagtaggaatatcagtataggaaaaatgcagcatgagcaactgacacca
tgttaacccagtctttttttcagtttcttacataactttatgtgttgtaattgtctacag
CATATCATGAGCTGAAGAAAAAGGCCCTCTCCCCAAAAAGTTACATGTCAGGATCTTTGC
ACGTTACTCATTTGATAAAAGAATTAGAAGAGAGTACGGGAAAGACGCTGCTGCACTGGT
CACATAATGTTATAAAGCAGGCTGCTTTCTGGTGCCTGGCCGGGCACCAGGACTGGGCAC
TCGGCAAAGGGTCAGAATGTCACGACTGTCAAGAGCTTGAGCTCTACAGTCAGGCAAGCC
TGCTTGCAAATCTTGTCCTTGCCACCAGCTGCCTGTGTGATCTTGGGCAAGTTACTTAA
tcttcctgaatctccatttcctcatttccaaaatggtgataataatagtaccttccttat
aagcttatgagaattaaattagacaatgcaggcaaaatgcttagcatggggcctagctca
cataagtgctccataaatattggctccagttgtgaacagaaagaaaagaaagagagtgaa

Exon 11 +      39728      39861   0    Initial    134    91   Excellent
cttgagctctacagtcaggcaagcctgcttgcaaatcttgtccttgccaccagctgcctg
tgtgatcttgggcaagttacttaatcttcctgaatctccatttcctcatttccaaaatgg
tgataataatagtaccttccttataagcttatgagaattaaattagacaatgcaggcaaa
ATGCTTAGCATGGGGCCTAGCTCACATAAGTGCTCCATAAATATTGGCTCCAGTTGTGAA
CAGAAAGAAAAGAAAGAGAGTGAAAAGAAGATAGAGGGAAAGGAAGAAAGAAGAAGAAGG
AATGGGAAAAAAAA
gtgagaaaggatgaatgaactttcactccattcagcttggaaaatgtgaaaactcaccct
tatgggattaaggctgatagatgtagctgggtttgtctccccagtggttcctgttgtggc
ccaagcaagggtgagtgactcagttaacaagtttgtatattatttgagaaaaaacatcta

Exon 12 +      44837      45062   0    Initial    226    69    Marginal
agtcgttttgttttgttttttaaataagagtttagcttctctaggtttatcaattaggtg
ggattgttgatagcaagcaatagaaactgggacagtttaagccacaaggggaagcttctt
ataaggatacagagtctctaggaactcaaacgttcgaatgcagtcaggcctcagggagaa
ATGGAAGCAGAACCAGAAAATAGTCCAGGATCTGGGCAGCATTTCTTTCCATGTCTTGTC
TTCACTGTCACTGTATATTTGCTTCATTTCTGTTTTTCTGTGGACCTCCTCGAGTCCACA
GACCTCACCATGGTGTACAGCTGCCAACAGCAACTAAGTGGCAATAGTGATCATCTGTGT
CAAAATCACAAATCAACAGAGAATTTACCTGATTGGCCCAGCACAA
gtcagttgattgcccctggtccaatcattgttcaccagtgagcagggtgatgttatacaa
catggctgccaggtgcccatctctgtgggggaggaagtagaaaggatcatggtaagccca
gcatactctcccaaaatgtctacaatgctttgttctgttgtctgataatgtgcttataaa

Exon 13 +      46108      46337   1   Terminal    230    83        Good
gctggcataatgggatttgcacacatggcatgggcccacagaacgagtataacagcccca
ggctgtaggaagagagggtcagggctctgtcctggaggatggacctcgtgactcctcctc
tggaggcatattggattccacccagaccttttcagtaacactccctggcttgtcttccag
GCTCCCTGGGTACAGCAGGCCGTGTGTGCAACCTGACTTCCCGGGGCATGGACAGCTGTG
AAGTCATGTGCTGTGGGAGAGGCTACGACACCTCCCATGTCACCCGGATGACCAAGTGTG
GGTGTAAGTTCCACTGGTGCTGCGCCGTGCGCTGTCAGGACTGCCTGGAAGCTCTGGATG
TGCACACATGCAAGGCCCCCAAGAACGCTGACTGGACAACCGCTACATGA
ccccagcaggcgtcaccatccaccttcccttctacaaggactccattggatctgcaagaa
cactggacctttgggttctttctggggggatatttcctaaggcatgtggcctttatctca
acggaagccccctcttcctccctgggggccccaggatgggggggccacacgctgcaccta

--------------------------------------------------------------------------------