--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45399 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1432       1523   0   Internal     92   100   Excellent
cgggtccgtgaccctccggctgctcggagtgaacaggcggccaggaaagaagcgggcctg
aacaccatgatccctttggagaagccaggcagcggcggctcctccccaggcgccacctca
ggctcgggccgggcaggccggggtctgagcgggccgtgccggccgccgccgccgccccag
GCCCGCGGGCTGCTGACAGAGATACGCGCCGTGGTGCGCACCGAGCCCTTCCAGGACGGC
TACAGCCTGTGCCCGGGCCGGGAGCTGGGCAG
gtgaggacgggcggggcccggcgcggaaccttcccggacgcgcggggcgggacgtgggcg
ccgataagtgccggcgccgcggcggcgaggctgaagtggcgttgctgctgccgataacgc
gcgttgtgacttggcacaaacttgggtgccgacggcaagtagggcagccgagtcgcacca

Exon  2 +       4411       4516   0    Initial    106    63    Marginal
atgatgtgggaagaaaaacagattttttttttcattttattctatggcctttcatttagt
aaaatgcagaaggggtgtgatgagttaactgttcaaacaaatcattctttttcaggtgct
actatgttatcacagatctaaaactttcaatgagatgactgttcaaagagaattttttaa
ATGGTCAACATTGATTCCAGAGTAATGACAGGATGTGATGTTGATCATTTAAGAAATGTT
GCATTCTTTCATGTCTCCAACAGAGTCCATAGCAGCGTAAATAAGG
gtaaatatatgatgtaaaacattcttttattgcttgaagcttgactggttaaggcttgtt
acctttctttgagtcaggatgtatgccaatgtaaaccacattaatgatttcgttactggg
gcacacaagagaaatgaccttgggttctgataattttttcgtgttgatttcccttgagtt

Exon  3 +       9715       9811   0    Initial     97    69    Marginal
taccatcttgcttgcccttcacagaaaaacttgctgaccctagtatagtacaggatatgt
tggaaagaaaagaataaatctagaactgtgaggaatgtttccagaaaaacaaaggtggtg
tcagtgtagtcattgatatgaaaggagagccgtgggaactgcattctagcacctaaagga
ATGGGTGAGGAGCATGAGCAACAGATGAATAAGTATGGGGAAGAGGCCCCAGAATTTAGC
AATGGCTGTTCTGTAACAGGGCTCCCACAGTTCACAG
gttagcaatgtgtgtgagtccgtgtttaatttgccctgttaaattctaacttctaggttt
tgatctttcattctagactactgacataattttgagttccaattctgtttgctgaattag
ctgtctttccatttggtctttaaaaatagactttcaggctatgtaataagtagtttttta

Exon  4 +      13972      14185   2   Terminal    214    88        Good
tgataaatctataaatctatagatgtagcctatataaatttctaagtgatgtttctactt
ttgtgattgtatataagctaaatttgaatatctaccaatgggtatttggaaatttcattg
aaatctgccatctctggaaagttgtcaactttaacagtgaatgtttttgtttaattctag
GGGGAAATTTGCAGTGGTGAGAAAATGTATAAAGAAAGATTCTGGGAAAGAATTTGCTGC
AAAGTTCATGAGAAAAAGAAGAAAAGGCCAAGATTGTCGGATGGAAATAATTCATGAGAT
TGCTGTACTTGAACTAGCACAAGACAATCCTTGGGTCATTAATTTACATGAAGTTTATGA
GACTGCATCAGAAATGATCTTAGTTCTGGAATAG
taagtattgtctttcttagattaagtttgtttggtagtctacacttcctttacggaatgc
cactcatctgtgataatgttgccaggcctggttctctggaaatctcagaattttctagat
catcttcaggtgttcctcttattaatataacatgttccaaatttgcaaggatgcatgtat

Exon  5 +      16606      16700   0   Internal     95    91   Excellent
ccagctactcaggaggctgacgcaggagaatggcgtgaacctgggaggtggagcttgcag
tgagcacagatcgtgccactgcactccagcctgggtgacacagcaagactccgtctcaaa
aaaaaaaaaaaaaaaggaaataggtcaaaaagtgaaatatataaatgtatatccccatag
TTGATAATTCTGTACACCTCCATTGATAACTGTGGTCCTCTGAAATACTACGACAAACAA
CCTAAGTCTTTTGACAAAATTGATCGAAAACCTCA
gtgagtcatcaccatatatgcagttgcccaaagagccaagagctcaagaaattttttttc
acaaatgcagatgtacaaaaaggacatctcttcatttattaagaaagtttaaatgttttt
gttgttcttttttggtttttggttttttttttttgagacggagtcttcctctgtgaccca

Exon  6 +      19544      19590   1   Terminal     47    47    Marginal
aaagaaataatacgaacatgagaagcacaaaagtatttgtcacagtgcatttctaattta
tgatagtaggaatatccaaaaatggcagaacggttaaaagtttttttaaaaaataagttt
aggaatctcatatgggagcccgctgcttaccaaggatttgtttttttctgtttattacag
ATAGGATTAAGGTAGAATTGGAAATTGATCCAGAAAAGACCACCTGA
aatttctgtctccaaaatctcctcattcttgcaaaacctgctcttcagcctttcatcctg
ggacccatttcagttcttccagtcttcacccggcttctgacttttttcttcccttttctt
tccttctcctctttagtagttaattcaattcctctcttaccagcacctcacattatttcc

Exon  7 +      21701      21817   2   Internal    117    87        Good
atataaaaagtgaaaaaacatagccccttatctccaggtgctaaaagtctagcaaaggaa
atagatatggaggttgaacattcttaacctggaaatgaaatgtcccaaagtttgaaactt
tgagcgctaacctgatgccacagtagaaaattccacatctgaccttatatattatcccag
AAAGATGCTGACCACAGCTGATAAGATCACCTTTATAGGAATTAAGGATGCTAAGGATAG
AATAACTATGCTGGGGGCTGTGCTAATGCAGCAGGTATGTGTAAGTGTAAACTTGCT
gtgattccacgtggtggcggagagtgacaccttcactttctgatggttcagtgtacacaa
actttgtttcatgcacaaaattatttaaaacattgtataaaattatcttcaggctatgta
tgtaagttgcatatgaaatataaatgtattttgtgtttagatttgggtcccctcccccaa

Exon  8 +      26331      26475   2   Internal    145    99   Excellent
gtttgagaccagcctgggcaacatagtgaggtcccatctctatttttcaaaataaaaata
cattttttaaaaaaggtatacagttactgccagactgtaattaatttactctgtagtttt
ggtgtaagtgttcgccatttcttatgagttatatattactttaattttgcccttctctag
TGCTGCTGGGGGTGAAATCTTTGACCAGTGTGTTGCAGACAGAGAAGAAGCCTTTAAAGA
AAAAGATGTTCAAAGACTTATGCGACAGATTTTAGAAGGTGTTCACTTTTTACACACTCG
TGATGTAGTTCATCTTGATTTGAAG
gtaagattcaaattacaattttgagattgctaaagaatgacattcaagacataaaatatt
taacagtgatttattcaaacatgtttcacgtttgtgtattattaggtaacaaggatatta
gaattgagtctttactcctatcctctagccagttagttttatcagggagataatgcacac

Exon  9 +      29456      29725   0    Initial    270    50    Marginal
tggaaaggtagtttctttttaaatactagtttcctacagaaaaatttactcgtttcctac
agaaaaatacagggaaaagaaaacaatgtggaagttttcttgttctcttttgaaagatgc
caatgtaaattcattttatacacatttatcttttctcaaagatattaattttttaatacc
ATGGCTAAAATGGACACTCAGGACCCAGTAGCCACATGGTACACAGTGGCGTTTTTTGAA
AGCAAGTGTGGACATGTGCACACCCACACGCTGAGGTGGCCTGATGTTAATGCTGAAGGT
TACCTAGTTAAAACCTTTCATAGCTTGGGTGGGGGCATTGCTTTTCCCCTTCAGTGTGTC
ATATGCATAAGAAGTTCAAAGATCCTTGCTGCAAGAAATTTCCACCTTGCTTCCCTCGGG
AACATTTACAAGGAAGATATGGCCTCCGCA
gtacggactttcactgggctaatactttaagtattagccatgcagaggaattcccaaaat
aaatgtttatgctgtagcttctttcatgtttggttttacactcttaactttgcaaaatcg
tgtatctgttttattttttaatgatgttttactagtcttatgatggacttccaggaagag

Exon 10 +      29881      29965   2   Terminal     85    81        Good
ttacaaggaagatatggcctccgcagtacggactttcactgggctaatactttaagtatt
agccatgcagaggaattcccaaaataaatgtttatgctgtagcttctttcatgtttggtt
ttacactcttaactttgcaaaatcgtgtatctgttttattttttaatgatgttttactag
TCTTATGATGGACTTCCAGGAAGAGAACCCCAATTTAAATAGCATTGCACCTATAGGAAA
TGAGCTTTCAGCTTATGACAGTTGA
acctgtgactattcaagaactaattaagtagcaagtcaaacaggttgtcagcaccatgtg
tcatggatctttgatgttacttgagagcatcaaaggtgaatattaagttcttgaatacca
actttaagtgtgtatttacacaaggaaattatatccctttctcctcagtatattcagtat

Exon 11 +      37673      37799   0   Internal    127    71        Good
gtacaggcctgctgccttatacataggcaataaattgtaaaaatatttctttaacaaatg
actgtttactgttaaattcctcagtctcagtttcataggtgaaatatgttttatgggctg
catgttttgtgtacttaatcatagttatattgatttttgcgggggtgtattttcttttag
CCTCAGAATATTCTGTTGACAAGTGAATCTCCATTGGGTGACATTAAGATTGTTGATTTT
GGCCTTTCAAGAATATTGAAGAACAGTGAAGAGCTCCGAGAAATTATGGGTACCCCTGAA
TATGTGG
gtaagtattcataaaagtagttttgttctggggtcaggcatcaccttcattaggggactt
gtccatgtggcatgactcatagtggagccagctatctactatgttgaaattctaccatca
gagatctattcctttggattacattttacaatggaaaacgttcaagagtaagataccaaa

Exon 12 +      41821      41965   1   Internal    145    99   Excellent
gatactagctcctgaaattcttagttatgatcctataagcatggcaacagatatgtggta
agagttattaatgaaaaattgatcaaattagtttcaagaaatgagtatggtactaaattt
ttcttgcattttctttctaatttaggagcattggagtgttaacatatgtcatgcttacag
GAATATCACCTTTCTTAGGCAATGATAAACAAGAAACATTCTTAAACATCTCACAGATGA
ATTTAAGTTATTCTGAGGAAGAATTTGATGTTTTGTCTGAGTCGGCTGTTGATTTCATCA
GGACACTTTTAGTTAAGAAACCTGA
gtaagtattatttttattagtttaatattgaactaattcaatattaaaaaattcagtatt
aaaaaactgacagttttttcttgaatctcctccaaccaaaaatagttcaacttctaaaac
accataatggaaacacaaaaatgttgacataaatctaggtgaaacccttggcttaatata

Exon 13 +      42595      42790   2   Internal    196    78        Good
tcagcattgtgggaaattgcacccaaattccaagactaatagttttattcaggaatcaca
gtaagatttttgccaacttgtcagacttcccaaaatataatgcaataaatacagtacctt
atgctctaattttaattgaagttctaacatgtcttaactgtaaaacatgtatctttacag
AGATCGAGCCACTGCTGAAGAATGTCTAAAGCACCCCTGGTTGACACAGAGCAGTATTCA
AGAGCCTTCTTTCAGGATGGAAAAGGCACTAGAAGAAGCAAATGCCCTCCAAGAAGGTCA
TTCTGTGCCTGAAATTAATTCGGATACCGACAAATCAGAAACCGAGGAATCCATTGTAAC
CGAAGAGTTAATTGTA
gttacttcatatactctaggacaatgcagacagtctgaaaaagagaaaatggagcaaaag
gccatttccaaacgatttaaatttgaggaacctttgctacaagaaattccaggagaattt
atctactgagcaatatttccctttagaacttcaagatttctacattgaaaatgttaatat

Exon 14 +      42810      43109   0   Terminal    300    66    Marginal
cctggttgacacagagcagtattcaagagccttctttcaggatggaaaaggcactagaag
aagcaaatgccctccaagaaggtcattctgtgcctgaaattaattcggataccgacaaat
cagaaaccgaggaatccattgtaaccgaagagttaattgtagttacttcatatactctag
GACAATGCAGACAGTCTGAAAAAGAGAAAATGGAGCAAAAGGCCATTTCCAAACGATTTA
AATTTGAGGAACCTTTGCTACAAGAAATTCCAGGAGAATTTATCTACTGAGCAATATTTC
CCTTTAGAACTTCAAGATTTCTACATTGAAAATGTTAATATTATTTATGGACCTCTGGCC
AAATGGTACATGTACTGGAAGTGGATAACCAGTATCACTTACACAAACAAAAATAACTTT
GTCAAATTTGTGGAGTTAGGTGGAAGCCAGATTTTAAAAGTTGCCAACCAGGAGATTTAA

caggtacagttacccgtttcaatgttatttttaagaagggagatgttggcacctttgaat
tctacatcctgtttctccagaatgagaatttgtgtacaaagatatttgtattcactttct
ttaaaaaatccaagtaaaagtgccaaaactacacttctgtaaatctcttgcattattcat

--------------------------------------------------------------------------------