--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14254 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        581        748   0    Initial    168    42    Marginal
acaaggttgttgacacaagagagccctcaggggcacagagagagtctggacacgtgggga
gtcagccgtgtatcatcggaggcggccgggcacatggcagggatgagggaaagaccaaga
gtcctctgttgggcccaagtcctagacagacaaaacctagacaatcacgtggctggctgc
ATGCCCTGTGGCTGTTGGGCTGGGCCCAGGAGGAGGGAGGGGCGCTCTTTCCTGGAGGTG
GTCCAGAGCACCGGGTGGACAGCCCTGGGGGAAAACTTCCACGTTTTGATGGAGGTTATC
TTTGATAACTCCACAGTGACCTGGTTCGCCAAAGGAAAAGCAGGCAAC
gtgagctgttttttttttctccaagctgaacactaggggtcctaggctttttgggtcacc
cggcatggcagacagtcaacctggcaggacatccgggagagacagacacaggcagagggc
agaaaggtcaagggaggttctcaggccaaggctattggggtttgctcaattgttcctgaa

Exon  2 +       2423       2694   2   Internal    272    92   Excellent
gagtgggatgggcttagaacctgaacatgtcatggtctcttcctgcaccttgccctagtg
ttcacttaccacctgcttgcaggaaacaagaagagcagggcccacagctggccagctccc
ctcccctcccgcctgtcttccagaacgattccttcaccagccctctttccattgctctag
GATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGA
AGGGTCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGT
GAGGGTGTTTCAGCAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTA
TGGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCA
GATTCAAGCAGCTATGGGATTCAAGATTGATG
gtgagccacgggacaccaggggaggtgggtggcatgcagaacagacctaccagaagccaa
ggaaaggctggctctggcttagccgagccaagccccatacagctgtgctgcaggggccac
cccatcttcttcccactacactccaagtcactggacccttgaatctccaagggtgtctga

Exon  3 +       4451       4684   1   Internal    234   100   Excellent
aggaaggagatacagaaaagagatttcatcctggaatgaaatctccctccagagagccct
gggaaagcacggtagcccccatccatcagagtggagccccttgtgggggaagtgggctcg
gctgggaaccctcaattcagcataagcctcacatgtcctctcctctctgtcccggtgcag
ACAAGGGCATGGCCCCCGCCCTCCGGCATCTGTACAAGGAGCTCATGGGGCCATGGAACA
AGGATGAGATCAGCACCACAGACGCGATCTTCGTCCAGCGGGATCTGAAGCTGGTCCAGG
GCTTCATGCCCCACTTCTTCAGGCTGTTCCGGAGCACGGTCAAGCAAGTGGACTTTTCAG
AGGTGGAGAGAGCCAGATTCATCATCAATGACTGGGTGAAGACACACACAAAAG
gtgagcaggcagggaaaggaaacccatttcctgggcctcaagagaaagggaatttggaaa
taaatccacatatcccagttgggtgcagtagttcacacctgtaatcccagcccaacactt
tgggaggtctaggcgagaggaaggcttgaggcctggagtttgagaccagcctggccaaca

Exon  4 +       5905       6177   1   Internal    273    85        Good
attcgggaggctgaggcaggagaattgcttgaaccccggagacagaggttgcagcgagcc
gagatcgcgccactgcactccagcctggcaatagagtgagactccatctcaaaacaacaa
caacaacaacaacaaaatcgtctaacttcctgatcttcctgatcattgattttcccatag
GTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTGGACCAGCTGACACGGCTGGTGCTGG
TGAATGCCCTCTACTTCAACGGCCAGTGGAAGACTCCCTTCCCCGACTCCAGCACCCACC
GCCGCCTCTTCCACAAATCAGACGGCAGCACTGTCTCTGTGCCCATGATGGCTCAGACCA
ACAAGTTCAACTATAGTAAGTCCAAGAGCCCCTTCCCCACAGCCCACAGCAACTGCATCT
CATTCCTGGGGTCTCCCAAGGAATACCCAAAAT
gtcaccctctgagggaggaagaccacagggaatgctcccctttaagggaggagagaccct
agaatatactccagctttgacaaagatttcccaagcaggagacatcaggataatgggaac
agaagacaggaggtttatcccatgaaggatgaagaagctgaaatccagagattccctcag

Exon  5 +       7725       7923   1   Internal    199    74        Good
gaaattaaaatactgaataggggagcagtgaacaggggatacccaaaagccaagagcgag
agagagcctggcttccagaaatagtggagaagccaggagaactaggtgaaaacccagtgc
tgggttgccatcagcgagagctggagccatttccaacgaaccatcttgtcgtcttcacag
CTGAGTTCACCACGCCCGATGGCCATTACTACGACATCCTGGAACTGCCCTACCACGGGG
ACACCCTCAGCATGTTCATTGCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCA
CCAACATTCTGAGTGCCCAGCTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCC
GCCTCCTGGTTCTGCCCAA
gtaagccaccccgctatctccccgacctaccaacccctctctcctggctccctaaagtca
ccgcccccaggttgaatttcccagatctgtgatgcttgcaggacatgcatgtgtgggagg
ctgatgggaaactgtggcctgggtttgattatgagtcttgcaatcatccctccccctgtt

Exon  6 +       9524       9624   2   Internal    101    91   Excellent
agaaagaaagaaaaagaaaggaaagaaagaacgaacgaaccaggcctccctctccaacct
tcacctccgtccctattctggccacttgattcgggggacacctggtaggggatggggaaa
ggtgggagctgccagccagaggggaccccggcttgagcagcctcttgctgctatctgcag
GTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGA
CATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAG
gtaagaagactttcctttgcattttctcaccccagtggactgcgggggcccctaagagga
aaaaggaacctctccttgagagcggcagctgatctaatcctgtatccacatctgtttcag
accaagagcctctccacgtcgcgcaggcgctgcagaaagtgaagatcgaggtgaacgaga

Exon  7 +       9771       9831   0   Internal     61    95   Excellent
agacagtttcaggctgacttcacgagtctttcaggtaagaagactttcctttgcattttc
tcaccccagtggactgcgggggcccctaagaggaaaaaggaacctctccttgagagcggc
agctgatctaatcctgtatccacatctgtttcagaccaagagcctctccacgtcgcgcag
GCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCATCCACA
G
gtgagtctggctcaggtgaggctccacgggtgtcgcctccatcgcccttcaggataactg
gtccccagacccggaaaggaccccgcagccctctcggcacagagcagctctgtctgtgct
cagccatcacccactccccacctgtttctcagcctggaaaacgggcttgggaccatggaa

Exon  8 +      11031      11134   1   Internal    104   100   Excellent
gactgaggtgggaggatcacttgagcccatgagttcaaggctgcagtgagccatgaaggt
gccactgcactcccacctgggcgacagagggagaccctgtctctaagaaaaacggcgggg
gtgggggtggtgccagtgccagcatccctctgttctaagacattgtcccttctcttgcag
CTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCT
TTGTGGTCCGGCACAACCCCACAGGTGAGCCTGGAACCCATCAC
gttccacatcctcccacccattctttctctcaggaactagtcccgacagatgcagacatc
cctctatccctgagagggctctgggcagggaacccataaccctaccctgcttcctgtccc
aagaggaggctaccttctatcacccacagacagtgccgggtccccgctctgtgactcagg

Exon  9 +      12527      12721   0   Terminal    195    85        Good
ttgtggtctgtgtcaccgtatctcaggaagtccagccacttgactggcacacacccctcc
ggacatccagcgtgacggagcccacactgccaccttgtggccgcctgagaccctcgcgcc
ccccgcgcccctctttttccccttgatggaaattgaccatacaatttcatcctccttcag
GGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGAGTGGTTTCCAAT
GTGTTCAATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTACCAGGACAGAACT
TTCCCCAATTACAGGGTGACTCACAGCCGCATTGGTGACTCACTTCAATGTGTCATTTCC
GGCTGCTGTGTGTGA
gcagtggacacgtgaggggggggtgggtgagagagacaggcagctcggattcaactacct
tagataatatttctgaaaacctaccagccagagggtagggcacaaagatggatgtaatgc
actttgggaggccaaggcgggaggattgcttgagcccaggagttcaagaccagcctgggc

--------------------------------------------------------------------------------