--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38790 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1274   0    Initial     74    81        Good
ggcggcggggctcggcgggactcgtcagcgccctgctgcggcacccgggccgctcaggta
agtaggaggcgtgtgcgggcggggccgagcgggccccaatccgtacgcgaggcaggaacc
gcccgccgcgcccccgagagctctcggcgccgcgcagtcgccgctgggcaccccgagacc
ATGGGGAAGCTCGTGGCGCTGGTCCTGCTGGGGGTCGGCCTGTCCTTAGTCGGGGAGATG
TTCCTGGCGTTTAG
gtgagtggcatcttgacagggcgtcttcgactctctttctctcctcttccaagtgaggtc
aggggctgcctggcgcccccttcctagcgggtaggaaagagcagctttggaacctcactc
ctccatctcacccagcaaaccgccccttgagactcgcttatggggaaagtgagctacttg

Exon  2 +       2837       2907   2   Internal     71    82        Good
acccacataatgtctacattatgtaaataaacatgaaaggaagtacctacttacttgtta
tgtcattcataaattatgataaagatagttaaccaacacgaagatgattgaagtccacat
ttaaacatacattttgaatgctgtgccttgacttccagggttgggttttatcttctacag
AGAAAGGGTGAATGCCTCTCGAGAAGTGGAGCCAGTAGAACCTGAAAACTGCCACCTTAT
TGAGGAACTTG
gtatgtatgtgacagtaccaagaggagccagcacagcttcttggtcgtcatccacctgac
tgagccctaccagctcatttaattacctgtcactacttaagccctcccagtgggacatct
gccccgtccactctgccccatgcaaggtcttcaggggtgtactaaatgacattctttgtg

Exon  3 +       7343       7398   1   Internal     56    62    Marginal
ttactatagagtagcatgcctgtgagattctccaaagttaatatggtttcccaagtaaat
ggttgaacaagtcaacaatttccaaaagaagtttccaaaagatatttgtagtttggactg
tgagacgtattttttaagccttcatatatgcatttttctgattctacccttcttttgcag
AAAGTGGCTCTGAAGATATTGATATACTTCCTAGTGGGCTGGCTTTTATCTCCAGT
gtgagtattttccatgctgctctcatgctcacatcaatagctgtatagacagtgcattaa
tgttgtcctctggagctgccagatggatccctatgctctcatcccacctccgggtaaacc
agtcaactaaaaaagccaaaacagaattttggagggctaattagaacaccacaggaatgc

Exon  4 +      17373      17575   0    Initial    203    55    Marginal
aagtccttttccatccagctttgttccattgctggtgaggagctgcattcgtttggagga
ggagaggtgctctgatttttagaattttcaatttttctgttctgttttttccccatcttt
gtggttttatctacctttggtctttgatgatgctgacgtacagatggggttttggtgtgg
ATGTCCTTTCTGTTTGTTAGTTTTCCTTCTAAGAGTGAGGACCGTCAGCTGCAGGTCTGT
TGGAGTTTGCTGGAGGTCCACTCCGACCCTGTTTGCCTGGGTATCAGCAGCGGAGGCTGC
AGAACAGCGAATATTGCTGAACAGCAAATGTTACTGTTTGATTGTTCCTCTGGAGGTTTC
GTCTCAGAGGGGTACCTGGCCAT
gtgaggtgtcagtctgcccgtactggggtgtgcctcccagttaggctactcaggggtcag
ggacccacttgaggaggcagtctttctgttctcagatctcaagctgcgtgctgggagaac
cactactctcttcaaagctgtcagatagggacatttaagtctgcagaggtttctgctgcc

Exon  5 +      24879      24921   1   Internal     43    64    Marginal
ccttatgttaattcttagccagctatactgtttgccactacatgatataatcgatgtagg
aatgggaacaatacaattaaactatacaccccttctctctgctttgaggaaggttagtta
tagaataccaggaccggaaataatcttataatcatgtatttgaacttcttcattttatag
ATGAGGAATGTGAGGTACGGGCATGTGAAGGGATTCACACAAA
gtaacagcctagtctcttctgttatatttttttggcttaactccttttctctaaattaaa
aactcttccttatcttgaatatggttctttctgtgttcatagccaatgtttagatgacat
cagtaacaccccagatcagatcatggaaacagctgacagagtgaaaaagcccagtaatct

Exon  6 +      25024      25094   2   Internal     71    88        Good
ttataatcatgtatttgaacttcttcattttatagatgaggaatgtgaggtacgggcatg
tgaagggattcacacaaagtaacagcctagtctcttctgttatatttttttggcttaact
ccttttctctaaattaaaaactcttccttatcttgaatatggttctttctgtgttcatag
CCAATGTTTAGATGACATCAGTAACACCCCAGATCAGATCATGGAAACAGCTGACAGAGT
GAAAAAGCCCA
gtaatctaaatgaaatttagaactttgaacatttttatttggctttgagattttaaattc
cttatgaaaatattgttttgatatgtatatgtgtgcacacttgttctttatttttaaaag
ggattaaaatatccaggcatgccaaactttgcgccagatgaaccaggaaaaatcttcttg

Exon  7 +      25231      25380   1   Internal    150    73        Good
cccagatcagatcatggaaacagctgacagagtgaaaaagcccagtaatctaaatgaaat
ttagaactttgaacatttttatttggctttgagattttaaattccttatgaaaatattgt
tttgatatgtatatgtgtgcacacttgttctttatttttaaaagggattaaaatatccag
GCATGCCAAACTTTGCGCCAGATGAACCAGGAAAAATCTTCTTGATGGATCTGAATGAAC
AAAACCCAAGGGCACAAGCACTAGAAATCAGTGGTGGATTTGACAAAGAATTATTTAATC
CACATGGGATCAGTATTTTCATCGACAAAG
gtaaaacctgtatgtttagggataagggggaaatgagggaaatagaaaccatttatctcc
agcccctcaatatttatgtaacaggaagagagaagatgctattttaccatacagatgtgt
ttttttaaaatgataaataggtataaaaccttgtaaacattgcattaaagaaggaacact

Exon  8 +      30066      30192   1   Internal    127    91   Excellent
caatttcctcaactaaatctggattctggcatttgtctgacttacctatcatgtagactg
tgagggtcaaatgcaagatgtaagaagaaaacttttggaagtgaccaagttttaaaacaa
gtctaatattagttgtgataggggtaactttcttggaaattatcccttttttccatgtag
ACAATACTGTGTATCTTTATGTTGTGAATCATCCCCACATGAAGTCCACTGTGGAGATAT
TTAAATTTGAGGAACAACAACGTTCTCTGGTATACCTGAAAACTATAAAACATGAACTTC
TCAAAAG
gtatggaatgaaagtattgtgcggttctatttactttgcacctctgctgtgtgctttgta
ttttttggttcagcaggctttcttaaacttttgttttgaaattgttttgatttttttcta
aagctttctaatgattcccatggtgactcttcccagcgcctcactagaaattgccatgtt

Exon  9 +      33491      33605   2   Internal    115   100   Excellent
aacccatcagggcaatgcagaatcatgattttctgtggaattccttaatccatactagtt
catgtatcctttttcaaattgatgaacgtattagtctatgtagagatgagtgattttgac
aaggataaaggatatttaaatacctcatgggtctctttttccacctccctttcactttag
TGTGAATGACATTGTGGTTCTTGGACCAGAACAGTTCTATGCCACCAGAGACCACTATTT
TACCAACTCCCTCCTGTCATTTTTTGAGATGATCTTGGATCTTCGCTGGACTTAT
gttcttttctacagcccaagggaggttaaagtggtggccaaaggattttgtagtgccaat
gggatcacagtctcagcagaccagaagtaagctcttttgtgtatttttctatcctttgcc
cttgacattttcgtggactcctttccttacgaggaagttacttccttacttaggcttacg

Exon 10 +      35073      35192   0   Internal    120    60    Marginal
tgagagcaatgccagtgagattatgcatgcgtttctaaaatacagaagcaaagcccccta
aaaacaccaactttaggtgccagaagaagctgtaggggttgtggggatgaatagggaaga
aagcgaggaatcattgagacaatgtcttcactactccctctttgttgtaaggtgatacag
TTGGGCACCTTAGTGGATAACCTGACTGTCGATCCTGCCACAGGAGACATTTTGGCAGGA
TGCCATCCTAATCCTATGAAGCTACTGAACTATAACCCTGAGGACCCTCCAGGATCAGAA

gtaagttcctatacctctctgagctcacaggcaaagctgcaagaacaaatttgttggggt
gacttggaagaatttaagccagtcacatttggtgttatagaactaaagaaattttacgta
tgagaaaagtaaagtttttgacaggtagggagataaggttcgttaactcttttaggccac

Exon 11 +      36004      36092   0    Initial     89    54    Marginal
ggcacacatactcagagatttattcacaaaaatttattgagtacctgtaatgtgtcagac
attgtacttatgtttaggatatatcagaaaaaatatacagagatccctgatcttaagaaa
gggggacaaacaatgaacaataagcataagaaataagtaaattacatagtaactttgaag
ATGGCAAATTTTATGGGAAAAAAGGCTCAGCAGAGTAAAGGGGATCAGGATTACTATATG
CAGCAGGATGAGCAGGTCCTACTACTAAA
gtcagagatcagagtaggcctcattgagaaagtacaatttgaaaaaaattaaaatgtgtg
aatccacatttggtgatttgagaaactgaaattcaaattcaaacccagtaattggcctag
tgggtaaattaggacatacagttatttctacttccagtattgctgtctttcagttaaaaa

Exon 12 +      37423      37570   0   Internal    148   100   Excellent
ttggtgcatagatatctatgacattagtactttcatcagaagaagaacaatttattgaag
atatacagattttagcttctgatttctgaaaaatagatttatcctagaatgtttgggaag
gacatcatgaaacaggtgtttactcacataatatactaataaacgatcttttctcgacag
GTACTTCGCATCCAGAATGTTTTGTCTGAGAAGCCCAGGGTGAGCACCGTGTATGCCAAC
AATGGCTCTGTGCTTCAGGGCACCTCTGTGGCTTCTGTGTACCATGGGAAAATTCTCATA
GGCACCGTATTTCACAAAACTCTGTACT
gtgagctctagactctagatagtaaaaaaaaaaaaaaaaagtctacatattttgtaaaag
taaactgataattgtatgataagtggcactgtaagtaaatagcaaacaccaaccagtgag
tgtggcttttcttatggatagaagtaaaggagcagacagagattccttgatagccatcaa

--------------------------------------------------------------------------------