--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17507 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1158       1266   1   Internal    109    67    Marginal
cttagtaggcgatcgataaaataactgatgataaaggggcttctgcagactccccaattc
atttggtaaagaccgctcagcatcatggtcgggccctgattgctttcacaaccgcttcga
ggagtgtcattcccatcacggccacaaggtggagcccacctccctgctctgggacctcag
GTCGCGACCCCGGAAGCACATCCTTCATCCTCTACCTTCCTTCTAGCAGAAATGGCGGCT
GCGGCGGCTCGAGTGGTGTTGTCATCCGCGGCGCGGCGGCGGCTCTGGG
gtttcagcgagagtcttctaatccgaggcgctgcgggacgggtgagcttccctccaggcc
ggtcctgtcctcgagatctcgccagacccggcgcagcgcacctgagagtcggcgccacag
atccgaacagtgggtcgggcagggcctcctcgacccggacccgccgggcgccaggcggcc

Exon  2 +       3927       4056   0   Internal    130    96   Excellent
tcagcttctcaaagtgctggggttacaggtgtgagccatcgtaccatacctgatgtactt
tagaaaccaaatttgaccctgcatgaaactaacttatgtcctccatattcattatctgaa
gtagaatagatgaagtataaagggagtttgcataatttgtttttcctcttttatttcaag
GGCACCAAGAAGAGATCCCAGTTAGATCTGGAACTTGAGATTGAAAATATGGGTGCTCAT
CTCAATGCCTATACCTCCAGAGAGCAGACTGTATACTATGCCAAAGCATTCTCTAAAGAC
TTGCCAAGAG
gtactgttattatttatacagcagataatgtaattttcatgagaatcaggaattatttag
tactatttttattatgtctgttgtaaaagagtaagttccagaaatgtgaaaaagcgaaac
tgaattctgggtgagggtacagctgatcttattttttttctaaatatgacaaatagtaaa

Exon  3 +       5245       5289   0   Terminal     45    61    Marginal
cctaacttttgcattaaaacaaaaatgacagcaacgatggagggtatgttggtttgaata
acaaaaccaatagagacagtttttgtcccaggactaattagggaccaagaacatatggct
aggccaaggttctttaaagagttgttcattccagcctagttccttcctttatttacacag
AACAACAGGGAAGGCAAAAAGGAGAAACAGAAAAAGGAAGGATGA
aattaaacgacttttttcccccttttctcctggcatctagctgggaacgacagagcttct
gctagtgggagtggaaaaacaggggctttccctgaggaatgcaaaatggaagtgctctct
gaagcagctccaactttggggatttacttggggtttttcacccttcaccctgggtgtgaa

Exon  4 +       7591       7793   1   Terminal    203    81        Good
ggggtttatatgttaaattttaattttgtcctgttaagtatatctgatgtttttctccta
ggctaatcatttagtattgagtgatgggtcagtgtcatgatttctgattttggtttaata
gattttaatagtgaaagttaagattgctggcacgttttcttatattttattttcaattag
CTGTAGAAATTCTTGCTGATATAATACAAAACAGCACATTGGGAGAAGCAGAGATTGAAC
GTGAGCGTGGAGTAATCCTTAGAGAGATGCAGGAAGTTGAAACCAATTTACAAGAAGTTG
TTTTTGATTATCTTCATGCCACAGCTTATCAAAATACTGCACTTGGACGGACAATTTTGG
GACCAACTGAAAATATCAAGTAG
gtataacagaatttcttggtgtataagggaatttatgaatgttgaaaataaacatttaca
aattttcaaaaagtatgtttcagaaagtaattttccccctggtaatctaagtgaaactgt
agttagctacattttagtcccacctagctcccaagcacgtgagttcataggtacttcggg

Exon  5 +      11345      11452   1   Internal    108    73        Good
tgcaacctcaagctttgcaacaccaaggaaataggtgtgctatgtgagcttactcttaaa
taatggcttttagtgagtgtagatagttcatgtgtaatgtacatcacattataccaccta
gggtttattgtaaactatattgctgctagatacatgtgaaaatattttctttcaatttag
GTGTTTCCCATGATGAATTGCTTGACTTAGCAAAGTTTCATTTCGGTGACTCTTTATGCA
CACACAAAGGAGAAATACCAGCTCTGCCTCCCTGCAAATTCACAGGAA
gtgaggtagggcaagccttccagctagtatttagccttttggattccttgtgttgtattt
acacataagtaaacaaaatgtgcatatttccagtaggaaaagaatggaataataggaaaa
gggaagaggatgtactcatttgcttacattccttcctcttccgtattctttaaccaccta

Exon  6 +      12722      12844   0    Initial    123   100   Excellent
tcaacaatgtaatgaggcctgatagttaaaaaatcaaaatagagtcctggtgtgcatttt
aactttgcagttaatgggactggtgattttttccttgttaataagcatgttatataatgt
taatcttaactagaggtcctcctgctttatcttaactagattcgtgtgagggatgacaag
ATGCCTTTGGCGCACCTTGCAATAGCTGTTGAAGCTGTTGGTTGGGCACATCCAGATACA
ATCTGTCTCATGGTTGCAAACACGCTGATTGGCAACTGGGATCGCTCTTTTGGGGGAGGA
ATG
gtaagtgattttaaaagaaattttccataacagatggaagattatcatgttttcttaaat
ataagttctttgtaagaatccttttttaaagtggcagaatagagtcttgtactgtgaatt
ctgacttaaaaatataaactgatcctggattgcatgtgggccagaaaaagtttctttttt

Exon  7 +      14064      14224   0   Internal    161    85        Good
taagtgagataataaacacaattcttagtcatactgaattttaactctactactgagatg
ttgaataaaactaggaaacagcctctaaggatattcactattttccacacactccatttt
tctttctgtattttggacatgtataattaaaattctcttggaatttttttttccttgcag
AATTTATCTAGCAAGCTGGCCCAGCTCACTTGTCATGGCAATCTTTGCCATAGCTTTCAG
TCTTTCAACACTTCCTACACAGATACAGGATTATGGGGACTGTATATGGTTTGTGAATCA
TCCACTGTTGCAGACATGCTACATGTTGTTCAAAAAGAATG
gtgagaaaaatagctttaagtaatttaaattttgcctttaattcgttttaaactagtttt
ttatttatactttatggtgatttatggtaattttaccttttaattaagagacctagataa
acagtagttgccatgttttcaaaggttgcagttggtttttcctaagtctcaagatgtgaa

Exon  8 +      15781      15880   0    Initial    100    66    Marginal
tataatagaaggattcccatccctgagcttgaagcaagaattgatgtaagtagtcctgag
ttactattgggtcatgtgtaaaaagatccttgttacaaaagctgagaatatgtatctttc
atcttgctttagttttaaaaagttccaggtatagactttgtttttactacaaacagctga
ATGACAGTGTCTTCCATATTTCAGGCTGTGAATGCTGAGACAATTCGAGAAGTATGTACC
AAATACATTTATAATAGGAGTCCAGCTATTGCTGCTGTTG
gtaagcctggcttcttttcttctatgcaaaaagttggccaagtacttttaattaactctt
ctttttaatccttaggtcccattaagcaactaccagattttaaacagatacgcagtaaca
tgtgttggcttcgtgattaaaatgctcctaatcaagattgtttgaacacatgtatttata

Exon  9 +      15956      16045   0   Terminal     90    63    Marginal
gctgaatgacagtgtcttccatatttcaggctgtgaatgctgagacaattcgagaagtat
gtaccaaatacatttataataggagtccagctattgctgctgttggtaagcctggcttct
tttcttctatgcaaaaagttggccaagtacttttaattaactcttctttttaatccttag
GTCCCATTAAGCAACTACCAGATTTTAAACAGATACGCAGTAACATGTGTTGGCTTCGTG
ATTAAAATGCTCCTAATCAAGATTGTTTGA
acacatgtatttataaaacagagctagagaaaaataaaaatgaacatgtatatacatttg
gaaatttgaattaaatactgtatcatactttcaaaggataaaaagactacccctctgaag
gttgttttgtattaatggtcagtctttgttctctgagaaattatgttggaagcagcatac

--------------------------------------------------------------------------------