--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14971 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1501       1791   0    Initial    291    84        Good
gcgcccgctcgcccatgccgagctgagcgcggcagcggcggcgggatgctggcgctgctg
gccgccagcgtggcgctcgccgtggccgctggggcccaggacagcccggcgcccggtagc
cgcttcgtgtgcacggcactgcccccagaggcggtgcacgccggctgcccgctgcccgcg
ATGCCCATGCAGGGCGGCGCGCAGAGTCCCGAGGAGGAGCTGAGGGCCGCGGTGCTGCAG
CTGCGCGAGACCGTCGTGCAGCAGAAGGAGACGCTGGGCGCGCAGCGCGAGGCCATCCGC
GAGCTCACGGGCAAGCTAGCGCGCTGCGAGGGGCTGGCGGGCGGCAAGGCGCGCGGCGCG
GGGGCCACGGGCAAGGACACTATGGGCGACCTGCCGCGGGACCCCGGCCACGTCGTGGAG
CAGCTCAGCCGCTCGCTGCAGACCCTCAAGGACCGCCTGGAGAGCCTCGAG
gtagcggcccgcggggagcgcgggggacctggaatggggacgctcccgagtcgggggcgg
aagactcgggaggatggggaaagggggcctggccctggggagggtgtgatcgtccgtggg
ggtgagctggacttgagggtgaaaggcggggatctagatcctgctcgggaactcccctgc

Exon  2 +       3553       3763   0   Internal    211   100   Excellent
aaatcttttccataccaaaaaagcatcagtgagatgctcccctgcctgccagtggcaaga
ttcagggcttgcgttttggaagcttctccctgtgtggtcgggccatcacagccacatttc
acaatttctttttaactctttctgtgcccctccctcctccccggtggctgaaagcaccag
CTCAGAGCAAACGTGTCCAATGCTGGGCTGCCCGGCGACTTCCGCGAGGTGCTCCAGCAG
CGGCTGGGGGAGCTGGAGAGGCAGCTTCTGCGCAAGGTGGCAGAGCTGGAGGACGAGAAG
TCCCTGCTGCACAATGAGACCTCGGCTCACCGGCAGAAGACCGAGAGCACCCTGAACGCG
CTGCTGCAGAGGGTCACCGAGCTGGAGCGAG
gtgtgtgcctggcctgtttctctgtctggcagtggcctgattttcaccacttgtggtcag
acatgcgattctggttgatggacagcagggattgtgacaccacatgggcctggttcccga
gtgtgtgagcaaataataaaggcgactgaacaaggtcatctcaggaatgagctgccagcc

Exon  3 +       8826       9070   1   Internal    245   100   Excellent
ccagacttcagccttttatcagtggctggtgtggagcggtctttggtcgcttgctggagg
gtccatcaaggctgtgtgagggaccttcttgtgggtctagcaagatgtggctctgggccg
tgctggtgggtggtggggtggcctaacgcactcctggcctctcttcctcccaacccccag
GCAATAGCGCCTTTAAGTCACCAGATGCGTTCAAGGTGTCCCTCCCACTCCGCACAAACT
ACCTATACGGCAAGATCAAGAAGACGCTGCCTGAGCTGTACGCCTTCACCATCTGCCTGT
GGCTGCGGTCCAGCGCCTCACCAGGCATTGGCACCCCCTTCTCCTATGCGGTGCCAGGGC
AGGCCAACGAGATCGTGCTGATCGAGTGGGGCAACAACCCCATCGAGCTGCTCATCAACG
ACAAG
gtgaggcccgcctgcaccgccaccctccccagaacccatcatgtggtggagggagccaca
gcccccaccccagccgtcctcgccctcctcgggccacacagcagtgtcccagacatggga
ctgcggggctgtcctcctcgaggtggggatagctttgcacacgccgggcggctcacaggg

Exon  4 +      11069      11280   0   Internal    212   100   Excellent
tgctctggggtcagggtttccaccaaggctgcccccttgcatgttctccacgcatgaccc
cggtgacaggaggagcagtgtggcccagggggactgtggggtgtccttcctgcttcctgc
cctgggggaccctgagggcgtgggcccagcaggtccttacctgcacattgctgctcacag
GTTGCGCAGCTGCCCCTGTTTGTCAGTGACGGCAAGTGGCACCACATCTGTGTCACCTGG
ACGACACGGGATGGCATGTGGGAGGCATTCCAGGACGGAGAGAAGCTGGGCACTGGGGAG
AACCTGGCCCCCTGGCACCCCATCAAGCCCGGGGGCGTGCTGATCCTTGGACAAGAGCAG
GTGGGTGCAGGGCAGGTGCAGGTGGGCACAGG
gtgggtgcaggatgggcacagggtggccgtgcgccctttcagggatggtgcgaggagggg
ccaactgagcagcacgaggccaggcctgcagctgttcctgctcccggccccagctgttgg
cccctcagacctggccacagtgtcctgacagccaggtcgggggagtgagaacccccgcag

Exon  5 +      12323      12507   2   Internal    185   100   Excellent
tcccagttctgacatgcctgggagcttcagaacctacagaaacaggtagtgttggtcaga
gctggggggcatcagagaaatgcccaaatctcctgtctgcagcccgtgtgcagggggact
tgtgaaccagccctgacgcagctctcttgttcccattccccaggacaccgtggggggtag
GTTTGATGCCACTCAGGCATTTGTCGGGGAGCTCAGCCAGTTCAACATATGGGACCGCGT
CCTTCGCGCACAAGAAATTGTCAACATCGCCAACTGCTCCACAAACATGCCGGGCAACAT
CATCCCGTGGGTGGACAATAACGTCGATGTGTTCGGAGGGGCCTCCAAGTGGCCCGTGGA
GACGT
gtgaggagcgtctccttgacttgtagccgccttctcctctgtccaggaggccgggatcag
gctgttgccatggaagttcagggccatagactgccccacttaaactcttgtcagtctggg
ctcagggttcccagagctcattccccaggaatctctaagaccagggctggggcagtgtct

--------------------------------------------------------------------------------