--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (77800 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1413       1897   2   Internal    485    58    Marginal
gattatccgagctctgcagaagtgcaccgctattgctttgggaggttaaaaaaaaaaatc
acacggtttccagtgaaaaagtgacagagggtggtggcctttggaaccgccgtgaagtct
tctgcctggaacccgaaacttgcatgctatggaacacccgctctttggctgcctgcgcag
CCCTCACGCCACGGCGCAAGGCTTGCACCCGTTCTCCCAATCCTCTCTCGCCCTCCATGG
AAGATCTGACCATATGTCTTACCCCGAGCTCTCTACTTCTTCCTCATCTTGCATAATCGC
GGGATACCCCAACGAAGAGGGCATGTTTGCCAGCCAGCATCACAGGGGGCACCACCACCA
CCACCACCACCACCACCATCACCACCATCAGCAGCAGCAGCACCAGGCTCTGCAAACCAA
CTGGCACCTCCCGCAGATGTCTTCCCCACCGAGTGCGGCTCGGCACAGCCTCTGCCTCCA
GCCCGACTCTGGAGGGCCCCCAGAGTTGGGGAGCAGCCCGCCCGTCCTGTGCTCCAACTC
TTCCAGCTTGGGCTCCAGCACCCCGACTGGGGCCGCGTGCGCGCCGGGGGACTACGGCCG
CCAGGCACTGTCACCTGCGGAGGCGGAGAAGCGAAGCGGCGGCAAGAGGAAAAGCGACAG
CTCAG
gtaagggcgcgccaggcaccctcgagagtgcgcgccgggctggaaaaggggcggagagat
actaggggagattctcgcactggagggtggcagcagggaagatgggaatgtgttgccctc
tgtggcttcctgcggccaaattcggcggtgaagctttggtcctgatatttggggacacgt

Exon  2 +       1779       1897   2   Internal    119    84        Good
ccaccaccaccatcaccaccatcagcagcagcagcaccaggctctgcaaaccaactggca
cctcccgcagatgtcttccccaccgagtgcggctcggcacagcctctgcctccagcccga
ctctggagggcccccagagttggggagcagcccgcccgtcctgtgctccaactcttccag
CTTGGGCTCCAGCACCCCGACTGGGGCCGCGTGCGCGCCGGGGGACTACGGCCGCCAGGC
ACTGTCACCTGCGGAGGCGGAGAAGCGAAGCGGCGGCAAGAGGAAAAGCGACAGCTCAG
gtaagggcgcgccaggcaccctcgagagtgcgcgccgggctggaaaaggggcggagagat
actaggggagattctcgcactggagggtggcagcagggaagatgggaatgtgttgccctc
tgtggcttcctgcggccaaattcggcggtgaagctttggtcctgatatttggggacacgt

Exon  3 +       4913       5019   2   Internal    107    84        Good
acacacacatatgcaaactctagcagcttcatgttttggaagcaaatatttatggacttt
aggcttcctttatgtaagtttattgacaattgaaaataaccaaatttaatagaaaaacac
accattatattttatatgtgttaaacatttttgtaactttgaacctgctacgctttccag
CATTATTAGCAAAGCCAACATCTGCCACGTCTTCAAAGGGACTCTTAAAAATCAAAACTT
TACAACTGCTGAAAAAAATCACTACAAAGCAGGTGATTCTGAAAAAT
gtctataaatagtgtgaattgcttggcttcaattacatttggttgctctttgagcaatct
agtagtaggaataaactgcccacttttagttaaaataactaaaattaattcattgatcga
actttagcttttgtgcatggttatacagtgtacatatctagatattttctattcaaattt

Exon  4 +       8831       8929   0   Terminal     99    58    Marginal
aattagagcatccttattaaatgcataatatgattataaatgttccaattacaaaattaa
atattaagcttgaagcatatatagttttgtgaagagtccagcaggcttaagctggcaatc
aatgatagttataaaagtccctgcagtttttgttttcttttgtttttcctctttatttag
CTCATTATTCTTCACACACTTCAAGAGAATCCCATAATGCTACAAGAAAAAAACAAATTC
GCAGTTATCTTACGTGACTGTGGGCAAGAAAATGACTAA
ggtgaaatcatctgtcaggctccgcaaaacctagaggagggtccagcttaggttggcaga
tgccagtagaattttaaaggcctagaattttactctttgaaaatatagccttaaattttt
gccagaaatgacacccaaatgaaaacttatttttgcaaagtgatagttatttgcaaatgc

Exon  5 +       9961      10022   1   Terminal     62    59    Marginal
aattataaataatttttcctccagaactattctttgctcctggaagtagagctgtataat
ttattttctagaatacccagatgtttaggaaagtataagtaagtggcaacacttttgcat
atttagccattagttgataaatcataaaagatttatcctatttcttaattatcatattag
ACAAGGAAATAGATGTCACACTCAAAGGGATAATTGAAGAGAGTTTGATGATGGCAATTT
GA
tggtgagtagaatgtagggaaaccacaggaaatgatgaatcccccagggtctgtccacag
ttggaatatattagcacccctaacctgagagggtaaatgcagggacctcttaccagaatc
caatgagcgcaacaggacagaagccttctggaaaagttgggacctcagatggaggattgc

Exon  6 +      24846      24953   0   Terminal    108    66    Marginal
ctcagtcactgggaacttcagtagggacgctagtgttctatctgtagaatagatttacag
attggttatttatagatgtgagaatgaccactatgttagtatatttcatgctacttacat
ccttgaattatttgataaaatggtatggaggcctcttaattgtggggcttctgttcccag
GGTATTGGTAATAACTTAGACTTTGACCTCCAGAACAAAATGCACTGTCTGTTAGATTAT
TTTCTAATCATGGGAATCATTGATTGGTTTAATGAACTGTGCTTTTAA
attttcatatgtcctgcattcagtcatgaatcttttggagtggtttcattttttataaat
ctcagtacgaaatacaaataaattaccaaaaatactcccagtcactgcacttttaaagag
gatgtggaaaaactttgaaggaatgggggcctgctccattgttctaagccaaaaatatca

Exon  7 +      37496      37707   0    Initial    212    56    Marginal
agaaacaattttcaaaggaacagtaaaagcaaattgaaaggtacctagaaggtaggtaaa
aaattaagtgtgaattgcactaagatattattgcagtaatcttagcacaagatgctgaat
ctggtgcaggtgttgcttgccatctcaaaggaaaattacacagaacattgcaactaagtt
ATGGGGTATGGAGAAAAGTGGAAAGCAGTAGAACTCTTTAATGATTTTGAGCCCACAATT
GGGAAAATTGTGGTGCAATTTACAGAGAGGTTGGAAAAGGAAGCAAGTATAGTTTTTGTG
AAGAGGAATTTAACTCTAAACCAGTTGACTTGTAAGGCATGGCCAAACATCCAAGTGGAA
TTTCCCAGTAGGCAATTAGAAGAGCTGGACTG
gtgagaactctcctgagatccacctctatttattactgatccttaaaacatttgatctat
aggcttgggcctatctggtcaccaactttgtgagtttggaccaaattgctttgtggcaat
ttaatatggttctagcactctgcttaatttctacagcgttggcttaatatggagacctct

Exon  8 +      40404      40467   0    Initial     64    45    Marginal
cctagatcattatccttgagaatgtctatgctaatgcataagattgctaagaaaaggaaa
tactgtaatatgagaagacaaagaaattgaaccatcaaagtagactcttgcataataagc
agaatcttaatgcttgttgagcttagctagagaatttactaaaatgtagcttgcagccat
ATGTCTGGAAATATCTTACCATTTAATGCTGAAAGCATGGGAACCTCTCTGAGATACTGC
TATG
gtgggttcatgaggcaaacttggattattggtaaaaataagcaattgtgatgttcttcca
acactcattttatgtatgtttgagtatcatagatttctgggaattggatgattacctttt
tctcaacagaaactttaatatttttaaggcatgatatctatcaaaaacaaatgtacttag

Exon  9 +      42745      42850   0   Internal    106   100   Excellent
ttttggtgaattgattgtcagattaacactacaagaaaggttattaatgaatcagaaaaa
tattatcagttttatagatgagcttttagaatatcactttcaatactgctgtctagtcat
tgagagaactttcaaattagctaatcatacctccttaccttaatcttctttctttattag
GTTATCACTAAGGAGATTGTTATCTATTATTTTATGACAGCTTCTGAATACCAGGATTCA
GTTTGTGAACTAGTAAGGTATTACAGCAGTGGGCGTTCTGGGGCCA
gtgagtagaggctctaggaagctgaccgttaaattttcaggaagtttgtaaccctcttga
agtcaccttagcttactggcttggaatcccctttggtgggtgtatttacttcatgggaag
tggcaaattgtacaaaacgagcatttcttccctcctaccagcacacaactgggtataatt

Exon 10 +      45101      45283   0     Single    183    71        Good
tcatatagagccttggccccctaaaagcacaaagaaacaaagctaaagggacctacccag
catatgcaatagttacaccctcaagagggggaaacctccactcaaatgaaagtaagttca
aaaataagaagtaatagcttctgcagataagaaggaaccagcataaataattctagcacc
ATGAAGAAACAGAATGCTCTGACACCCTCAAAGGACCATGTTAGTTCTTTAGCAATTGCT
CCTAACCAAAATGAAAACTTTGAAATGAGAGACAAGGAATTCAAAATATGGATTGTAAGC
AAGATCAATAAGATCCAAAAGGAAGTTGAAAATAATCACAAAGAAACCAGAAAATCAATT
TAG
aagacaaaaggcaagatagatatattaaagaaaagcaaaatagaaactttggaaatgaaa
aatgcactaaaggaaattcaaaacactgtggcaaacttagcagtagagtagaacaaacag
aaaaaaatgaaattcagagcttgaagactgtacttttgaattatctcagtcagacaaaaa

Exon 11 +      51707      51808   0   Terminal    102    56    Marginal
ttttttctcaaaccctctatatgaagaaactcataattagagaaaatttctaagtaaata
acagcacaacatttaagagaatcggcttgtaagtgttttcagtaaatacttcttatcttg
gtcttctaaaaatccatttagaagtattaattaaactttttttaatactttaaccactag
GCAGAATGTGACTCCTATCTTCCTACATTTATGTACCTGTTTGACAGGACTCTAAAAGAG
AAGAAACACACATACTCACACAAACACAAGCACACTATCTGA
ctccgttttattgggtatgccaggtttggttatgtttcattgaatttccaaataaaactt
gcagaggaaatacaatttcatacactgataccactaagccttgtaaagtgtcacctcccc
aggttccttggaaaattgtaattaaactttcagcttcgtttgtacattagccaaaaataa

Exon 12 +      53971      54081   0     Single    111    54    Marginal
ttaaaagttaatagaaagcaataataaatgatacttttcctttttctaagctgaaggtca
gttaaatttctatgccagaacaaggctccttagggttatctttgtaattataatctataa
tcagatcgtaaagtcaaagatacagcagaatagtaggtatttagtattagaaatacaaag
ATGAGGAAGACAAAATTCATACTCATAAGTTACCCAGAGTCTAGAGTCCAGAGAAGCAAA
GCAGACATGAAAATAAATGAAAAGTTCAATAATTTCTACATCACTGCTTAA
aaatacattaaagcgactatgatgacttgctaaagaaatggctcagaattacagcataaa
tgctagtccttacactctgagaaggtgtggacttgtctttcataatataaataaaaaact
ccatggaagttttcctgttgcatgtccaagggttttactgcactaccggcagaattggtg

Exon 13 +      55647      55700   0    Initial     54    41    Marginal
ctgaattcatatattgatgggcacaaaaaataaggaattaaaatgagttatgtactatgc
acctattttaaaatggctaaaatttctgtaacttccatcacctcaaaactgtagagaaga
gaggaggaagcaaaaagaaagactttgttctaatactagccagtttattccagcaatgca
ATGCAACGCCAAGGAAATTTTATTACCTACTTCAAGGAAACGTCTACATCTAAG
gtatggaggactttagagacctaagtattttatttttgtataaattctgagatatgtgtt
tgcaaatttttcaaatccatatccatgctaagttgctaaatttctaccaatttaagaata
atcttgtgctattttctcctctctctctctctttctctccacacacacacacacacacac

Exon 14 +      60904      61068   0   Internal    165   100   Excellent
agaattatatctccccccgttgagctgccgtcagtcttgctgtctttggtctctatttgt
tccatgtctagcgcagtacctggaaaagtagtaattcaataactgtgaataatatgattg
catgtgtttgaataaatgagttattaccaattctgtctcccttttttttcagactcccag
GAAGGAAATTACAAGTCAGAAGTCAACAGCAAACCCAGGAAAGAAAGGACAGCATTTACC
AAAGAGCAAATCAGAGAACTTGAAGCAGAATTTGCCCATCATAATTATCTCACCAGACTG
AGGCGATACGAGATAGCAGTGAATCTGGATCTCACTGAAAGACAG
gtaaagctgggcattatcattatatgatcttttttaattgccctgggtccacagtcttct
ttgccatatttgaaatacctagatccagaattcttgaataccatttggaagacagttata
ctattccatgataaaattttgccagcaaaataacaaaattaaaaataatatagtgatatt

Exon 15 +      64787      64837   1   Internal     51    97   Excellent
aaatattttcagtttattttctggaggttggggttttaaagttattaacagaattacaaa
cagaacactttaaaatccatcttctgtaatttgcaatgcagcttgtagtctattggggct
gctataatgaaataccatagactgggtggcttataaacaacacacatttatttctcacag
TTCTGGAGGATGGGAAGTCCAAGATCAAGGCATCAGCAGATTCGGTGTCTG
gtgagcacacacttcttcatagacttccatttttccattctaccttgatatgatggctga
agaggctaggtagctctctgggacctctttaataagggcactaatctgagtaatgctaga
tctgttcttacgacctaatctcattccaagggccccatctcctaatgccgtcaccttgag

Exon 16 +      66039      66211   1   Terminal    173    54    Marginal
tagtagggacggggtttcaccatcttggccaggctggtcttgaactcctgacctcgtgat
ccaccagcctcggcctcccaaagtgctgagattacgggcttgagccatggcacctggcct
gtaacagaattgtttttgagaaataattttctcctaaatgaaaacttactttacaatcag
AACTAGTCTTTAGACATATTGTCATGTGGAAATTGTACATGATTGACAATAAAATGTGCA
TGTCTATCACTGATGTTATTTGTGGCTACCCCTACCTTACTTATATCACCGATCAGTATA
TCCAACACAAATTTTATGATGACTCATATATGTGTCATGAAGATTTGCAATAA
taattaggtttccttttagaaaaacataaggtatattaaatccttaaatatcactcagga
cttgaatttccaaattccattctgaagaatagtcatggaatcacacaaagatgtcacact
cttacatttgcatcttccataatgcaatgtcagggtagtctataattctgtttgaacttc

Exon 17 +      66763      66851   1   Internal     89    79        Good
ctaacttacagcttctagtttacaacatattctcatataaccttcaagatcaacagataa
taatcttcaattgtcagagtcaccccgaatgatttgcagagaactcagtctaaaggctct
ccagtttcaaggtatttttaatttggacaagcttattctggcgtttttttctccatccag
ATAAACTTGGAGAAAACTCCCACCAGATTTTTAATATCTCACAGTGGGAAGACGAGAGAA
AGCAGCTGCAGGAGCATATAAAAGAAGTG
gtaaaatggacatttttatagagttaaggctgccaaatatagacagaatgggagatcctt
tcacttcaaaacatctttttcacagagctaatcaaaggtgtaatgttgtagacttgtaaa
ctagttaagattactggaataaacagactaaattaatgatacttctgccaagataaatgg

Exon 18 +      75225      75426   2   Terminal    202    58    Marginal
ttaaattcaacgtggatttatttttctattcactccttcatggtgtctttgtataagcct
ttgaggaacttcttttcattgatgacactaaggagaaaaaaatgtcactttaattatctc
tttttttctgtttgtttgttccctttcttggttgaaggtgaaagtctggttccaaaacag
GCGGATGAAGTGGAAGAGGGTAAAGGGTGGACAGCAAGGAGCTGCGGCTCGGGAAAAGGA
ACTGGTGAATGTGAAAAAGGGAACACTTCTCCCATCAGAGCTGTCGGGAATTGGTGCAGC
CACCCTCCAGCAAACAGGGGACTCTATAGCAAATGAAGACAGTCACGACAGTGACCACAG
CTCAGAGCATGCGCACTTATGA
tataaacagaggaccagctccattctcaggaaagaaatgttgtgatggcaagccttaccc
aaatatcgtttacacagagagatgactatggcagtgatgtttaatattataaaatccagg
catttcgaatctgtttttcatgatttatagagggtttacacaaagtgccacttattaaag

Exon 19 +      75577      75687   0   Internal    111    69    Marginal
gaccacagctcagagcatgcgcacttatgatataaacagaggaccagctccattctcagg
aaagaaatgttgtgatggcaagccttacccaaatatcgtttacacagagagatgactatg
gcagtgatgtttaatattataaaatccaggcatttcgaatctgtttttcatgatttatag
AGGGTTTACACAAAGTGCCACTTATTAAAGAGCTTCCACAGTGAAGATGGAGAAGGTGAA
CTTGCTTTGAATATTCCAGATGTGTTTGGTCATGCGTATGGCAGTGAGCAG
gtatgtgtttgcttttgcttgcactgaaaattaaattgctatcaagagcaaactatgaac
ggttttttattcaagatgtctccagagtgaagatgccgaggatgaacttgcattgaacat
tccagatgtgtgagatcatgtgtattacagtgggcaggtatttgcttttgcttgcactga

Exon 20 +      75773      75820   0   Terminal     48    72        Good
gccacttattaaagagcttccacagtgaagatggagaaggtgaacttgctttgaatattc
cagatgtgtttggtcatgcgtatggcagtgagcaggtatgtgtttgcttttgcttgcact
gaaaattaaattgctatcaagagcaaactatgaacggttttttattcaagatgtctccag
AGTGAAGATGCCGAGGATGAACTTGCATTGAACATTCCAGATGTGTGA
gatcatgtgtattacagtgggcaggtatttgcttttgcttgcactgaaaattaaattgct
atcaagaataaaccatgaaacattttatcctgaacagccacagtgcctgaattcactcaa
gtggataaaaagtgtattttaactctgtatatattacccttaagtcattttcctgtcttc

Exon 21 +      76640      76659   1   Terminal     20    47    Marginal
gatagaaaacaaaattctgaatatcttcaaattaaattcggtaaaaacacattatttttt
catatgtgatgtattcatgcagaacaactatctttgtattttgtttttaaaatgtgttta
ataaatgatcctttgtaaataactttggtctccctacattaattttcttaatttttatag
ATTTCAATATCAATGATTAA
caaagtctcaaatctatctgcacttgtgcaaatccagatgattataattagtggattatt
tacattttttcatttctgaatttttttattatggcaggaaaaaaataaatccttgtgtaa
tcaaagggcgcctaagaatgggcatatattaagctatttctctaatttgaagaatacagt

--------------------------------------------------------------------------------