--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34716 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2250       2274   0    Initial     25    41    Marginal
tgctctggtggaggtggcagcagggtggaatggactctgtgaaggtccttagttttggtt
gcttaatgcactatttttgtattggcctcctgccaggaggtggcactttgaagagagcat
cagctgtagtagcataggggcatcaggcagtgggcagggccctagaattcccaaaagtat
ATGCCCTTTGTCTTCAGCTGCCAGG
gtgggtagggaaggaccatcaggggggcagggctaggcatgtgtgagttcagactctcct
tgggttggtcttggtggcagctgctgtggtggatgggggtgttgttcccaggccaatggt
gttatattcccaggaggattagggttgcctctgctgtgtcatgcaggttgtcaggggagt

Exon  2 +      25029      25267   1   Internal    239    64    Marginal
cagctaccgatattgaatatttagccaaagtgacctttgaagaaagtgcaaaagctttca
tgaaggaaaccatcaaattgggaattaagagccgacccaaaggcctttggggttattatt
tatatcctgattgccacaattataacgtttatgccccaaactactctgggtcatgcccag
AAGACGAAGTCTTGAGGAACAATGAGCTCTCTTGGCTCTGGAACAGCAGTGCTGCTTTAT
ATCCTTCTATCGGTGTCTGGAAATCCCTTGGAGACAGTGAAAACATTTTGCGCTTCTCCA
AATTTCGGGTGCATGAATCCATGAGGATCTCCACCATGACATCTCATGATTATGCTCTGC
CTGTATTTGTCTACACAAGGCTAGGGTACAGAGATGAACCTTTATTTTTCCTTTCTAAG
gtaagaagcttcttgtccaatggtgggggatttcctccttatctctaaaaggacatttct
ttgttaattatgttctttgaagaattgatttcaattaatggtttgttatatgggagcata
attcttccttgactagtcatgcatttagactcttcatttatggaaactgaattttgatta

Exon  3 +      32085      32121   0   Internal     37    70        Good
aattgaatttttttgcaagtccatgatgatctgatattattctcagaatttcacagtctc
aatttgttgctactgagatagtgttcatgaaactgtttatgcctatgcccacatatgaga
attaggtagaaactgagaggattaattcctgactttccaggtgtgatatttccaccccag
TCCCTTGGTGGCTCGTCAGAAGAGCTTCATCAGGAAG
gtgggtgcacacaggtggcctctgtttagaacacgtaataggaaccatatacacaaaagt
tacttagccatataggttttcatgtgtttgaattgtattagaagtacaggacccaggaca
gttgatggaaattaacaggaaaatccagaaggctataatacttggtagaatggtggcata

Exon  4 +      32793      32870   0   Internal     78    52    Marginal
tagtgcccaggagcctacaagttcaacaactgaaccaagccattatgttttaatcaagac
caaagaactgtgctagaagctctaattctatcagtaccagcgagaaacactaaaatcgat
ttctttgtacatttctaccagggagaacacactaaaattgatttcttcctacatttctag
GCCAACTGTACAAAGGTGAAGCAGTTTGTGAGTTCTGATTTAGGGAGCTACATAGCCAAT
GTGACCAGAGCTGCTGAG
gtatgcagccttcacctctgcaggaacaatggcaggtgcataaggaagatgtggaacgcg
cccagttaccttcacttgaaccctgcaagttaccacatagaggcctctgaggacggggag
tttactgtgaaaggaaaagcatctgatacagacctggcagtgatggcagatacattttcc

Exon  5 +      34537      34653   0   Terminal    117    73        Good
tctgggattataggtgtgaaccacggcacccagcctcaaccaactgttgattaccaaagt
aatgggaaagtgcaggataaaacagggtcttgggcaatttctacttcttgatgctatatt
ctgtttaaaatcacttatacgcattgtgtttttctcttgagagtcatgtttaattgatag
GACTTCCTTCTTCTGGAGACAATCTACTTGAAAGGTAAACTCAAAGTAAGTAATGATGCT
GTTGTAGAAGAAATTATAGTTGATTCAACCTCCTTCTTCACCTCTGTTTTTCTGTGA
aacatttgaaatccaggtgtgttcttttcaactgcgagtctatgcttgttggaggttatt
gaca
--------------------------------------------------------------------------------