--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16005 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1664   0    Initial    464    89        Good
accatctccaacggatgctcactagcaggaaattggggccaaattcacaggcactttcca
gaaactcccccactggccagaggttgcaaacatccggattggctctgggcacagtggccg
ccttaagtcctcctgaacaccccttctgcaagtaccccagggcggtctcctgacccagag
ATGGATTTACCTGTGAACCTAACCTCCTTTTCCCTCTCCACCCCCTCCCCTTTGGAGACC
AACCACAGCCTCGGCAAAGACGACCTGCGCCCCAGCTCGCCCCTGCTCTCGGTCTTCGGA
GTGCTTATTCTCACCTTGCTGGGCTTTCTGGTGGCGGCGACGTTCGCCTGGAACCTGCTG
GTGCTGGCGACCATCCTCCGTGTACGCACCTTCCACCGCGTGCCCCACAACCTGGTGGCA
TCCATGGCCGTCTCGGATGTCCTGGTGGCCGCGCTGGTCATGCCGCTGAGCCTGGTGCAC
GAGCTGTCCGGGCGCCGCTGGCAGCTAGGTCGGAGGCTGTGCCAGCTTTGGATCGCGTGC
GACGTGCTTTGCTGCACGGCCAGCATCTGGAACGTGACGGCCATAGCCCTGGACCGCTAC
TGGTCCATCACGCGCCACATGGAATACACGCTCCGCACCCGCAA
gtgcgtctccaacgtcatgatcgcgctcacctgggcactctccgctgtcatctctctggc
cccgctgctttttggctggggagagacgtactctgagggcagcgaggagtgccaggtaag
ccgcgagccttcctacgccgtgttctccaccgtaggcgccttctacctgccgctctgtgt

Exon  2 +      10052      10174   0     Single    123    51    Marginal
ttctagagcttctcttaaatatcttaactcactaatttttcattcatcagatgtttttca
ttaagtaaaaaaagtttggcatttgtgaagaaaattgcaagagttaggatcataatgcaa
ttttaaataggaaatagaaattcttaaaaaagaggattgagatttggacataaacaagcc
ATGGCACATGAGGAAGAGGCAACTGTGGTTGGTCAACAGTTCATGCTTGTGAATAGTGTC
TCAGGGTCCTGGACCAAACAGATGGAGAAGGGGACACATGATTGTCCGCACAACTATCAT
TAA
gctggaaaacaacaggacaaagtgatatattttcacaagtcgacaagtcaggaatgccct
catacgagctttgtaggggaccccaagcaaagtttgatcaattgctttttcataaattgg
tcactggcctaataatggtcttcaaatcattagccctcaggtccagcttgaattagattg

Exon  3 +      12346      12859   2   Terminal    514    77        Good
aatcagtgtcactctttcttctgtcaagtgagttggcattgaatgcagcaccaaagatgg
cccagtaaaataatcaacatttcacaaggtaatagaaaaatatgcttttctgaacaacgt
ggagttctatgactaaactctaaaaaaattctaagccctaagtgtcattgatatcaccag
TGTGATCATCACCACTGTGAACAGTATCTTCAGTGTGACCAGCATCTCCAGTATAATCAG
CATCCGTGGTGTCTCCAGTGGGACCAGCATCCCCATTGTGAACAGCATCTCCAGCGTGAC
CAGCATCCACAGTGTGAACGACATCCACACTGTGAACAGCATCCATGGTGTCACCAGCGT
GACCAGCATCCACAGTGTGAATGGCATCCATGGGGTCACCAATGTGACCAGCATCCACAG
TGTGAACAGCATCCATGGTGTTACCAGTGTTACCAGCATCCACAGTGTGAATGGCATCCA
TGGTGTCATCAGGGTGACCAGCATTCACAGTGTGAACAGAATCTTCAGCGTGACCAGCAT
CTCCAGTGTGACCAGCATCCCCAGTGTGAACAGCATCTCTAGTATGATCAGAATCCATGG
TGTTTCCAGTATAACCAGCATCTCCAGTGTTACCAGCATCCTTTATGTGACCAGTGTGAT
AAGCCTCCACAGTGTGACCATGTCTCAAGTATGA
ccagtgttaccagtgtccccattgtcactcataaaaatgtgccaaggggaaggagacttt
ccagagggttgaagagtccagctagaattcttgttttattgccgtcttgggacaatatgg
aaaacagcttccctgatattattagggggttgaattctgttaaggaaactggtagctttc

Exon  4 +      14501      14806   0     Single    306    90   Excellent
gagcgagtgccacaggccttcaggttcccacacctatccatcgaagactttcccttgagt
ggatgtgcggaatccaggcctgtcagtgtccaggctcagcctagcaggtagactgaggtg
gctcctcataaagctcctgcttgtcttttacaggtgaaggactctgccaaacagccccag
ATGGTGTTCACGGTCCGCCACGCCACCGTCACCTTCCAGCCAGAAGGGGACACGTGGCGG
GAGCAGAAGGAGCAGCGGGCCGCCCTCATGGTGGGCATCCTCATTGGCGTGTTCGTGCTC
TGCTGGATCCCCTTCTTTCTCACCGAGCTCATCAGTCCCCTCTGCTCCTGTGACATCCCC
GCCATCTGGAAAAGCATCTTCCTGTGGCTTGGCTACTCCAACTCCTTCTTTAACCCCCTG
ATCTATACGGCTTTCAACAAGAACTACAACAGCGCCTTCAAGAACTTCTTTTCTAGGCAA
CACTGA
gggagaggaccaggattgaaaaaagtttcttcccataattcagtggaattcccagttcat
ccatttcccatccccacccaacagccatgtggacgggatgaatcctcaccattctccagg
gtcatcttcagaactgcactggccgcttttccacctcctcagtaggaatatgactcctca

--------------------------------------------------------------------------------