--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23232 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      17583      17784   0    Initial    202    64    Marginal
attgagagtaagatggatttgcgcggagccctcaccgcgctgcgcttctcgccccaccag
gtctgcgcggggcggccattggcggcggagtgtcacgtgaccgcgggggcgtgccaatgt
gcgccctcacgggtgtcaaacccctgtcagagtgtgcgatcaagatcgtgaaacaacgcg
ATGCAAAAAGCGACCTACTACGACAGCTCGGCGATCTACGGTGGCTACCCCTACCAGGCA
GCCAACGGGTTCGCTTATAATGCCAATCAGCAGCCGTACCCGGCGTCCGCCGCTTTGGGC
GCCGACGGCGAGTACCACCGACCCGCCTGCTCCCTCCAGTCTCCCTCCAGCGCCGGGGGC
CACCCCAAGGCACACGAACTGA
gtgaggcgtgcctgcgcaccctgagcgccccacctagccagcctccaagcctgggagagc
cgcccctgcacccgccgccgccccaggccgcgccccctgccccacagccgcctcagcccg
cacctcagccccctgcacctacccctgccgcgcccccgcctccctcttctgcctcccctc

Exon  2 +      17970      18108   0   Internal    139    97   Excellent
gcgtgcctgcgcaccctgagcgccccacctagccagcctccaagcctgggagagccgccc
ctgcacccgccgccgccccaggccgcgccccctgccccacagccgcctcagcccgcacct
cagccccctgcacctacccctgccgcgcccccgcctccctcttctgcctcccctcctcag
AATGCCAGCAACAACCCTACCCCTGCCAACGCGGCCAAGAGCCCCCTGCTCAACTCACCC
ACAGTGGCCAAACAAATCTTCCCCTGGATGAAAGAGTCTCGACAAAACACAAAGCAGAAA
ACCAGCAGCTCCAGCTCAG
gtaaaggagtgccttctggaagagggtcctctggcctggctcctggtccccaagctactg
cccacgacatccagcacagcctaggagcgatggagcatgtctggaattcactgctcccac
accactgcccaccaaaaaggttttcatagtctttgcaacttagggaggtgataggcctct

Exon  3 +      19503      19769   1   Internal    267    87        Good
agggagtatcactgttttacccaccaggagagaggatagcacctagttcctacttctctc
tgggacctgacggatgcaggaacctttggggcctggtggaaggaggggccgggctgggtc
aggggctgggcggggccgcggcagcccctgacgccgctcttcctctctctgtcctcgcag
GCGAAAGCTGCGCTGGCGACAAGAGCCCGCCGGGGCAGGCTTCGTCCAAGCGCGCGCGCA
CGGCCTACACGAGCGCGCAGCTGGTGGAGCTGGAGAAAGAGTTCCACTTCAACCGCTACC
TGTGCCGGCCGCGCCGGGTGGAGATGGCCAATCTGCTGAACCTCACTGAGCGCCAGATCA
AGATCTGGTTCCAGAATCGCCGCATGAAGTACAAAAAGGATCAGAAGGGCAAGGGCATGC
TAACGTCATCGGGGGGCCAGTCTCCAA
gtcgcagccccgtgccccccggagccggtggctatctgaactctatgcattcgctggtca
acagcgtcccgtatgagccccagtcgcccccgcccttctccaagcccccccagggtacct
acgggctgccccccgcctcctaccctgcgtccctgcccagctgcgcacccccgccacccc

Exon  4 +      19503      20308   1   Terminal    806    83        Good
agggagtatcactgttttacccaccaggagagaggatagcacctagttcctacttctctc
tgggacctgacggatgcaggaacctttggggcctggtggaaggaggggccgggctgggtc
aggggctgggcggggccgcggcagcccctgacgccgctcttcctctctctgtcctcgcag
GCGAAAGCTGCGCTGGCGACAAGAGCCCGCCGGGGCAGGCTTCGTCCAAGCGCGCGCGCA
CGGCCTACACGAGCGCGCAGCTGGTGGAGCTGGAGAAAGAGTTCCACTTCAACCGCTACC
TGTGCCGGCCGCGCCGGGTGGAGATGGCCAATCTGCTGAACCTCACTGAGCGCCAGATCA
AGATCTGGTTCCAGAATCGCCGCATGAAGTACAAAAAGGATCAGAAGGGCAAGGGCATGC
TAACGTCATCGGGGGGCCAGTCTCCAAGTCGCAGCCCCGTGCCCCCCGGAGCCGGTGGCT
ATCTGAACTCTATGCATTCGCTGGTCAACAGCGTCCCGTATGAGCCCCAGTCGCCCCCGC
CCTTCTCCAAGCCCCCCCAGGGTACCTACGGGCTGCCCCCCGCCTCCTACCCTGCGTCCC
TGCCCAGCTGCGCACCCCCGCCACCCCCACAGAAGCGCTACACGGCGGCAGGGGCGGGCG
CAGGGGGCACCCCCGACTATGACCCGCACGCTCATGGCCTGCAGGGCAACGGCAGCTATG
GGACCCCACACATACAGGGAAGCCCCGTCTTCGTGGGGGGCAGCTATGTGGAGCCCATGA
GCAACTCCGGGCCAGCCCTCTTTGGTCTAACTCACCTCCCCCACGCTGCCTCGGGCGCCA
TGGACTATGGGGGTGCCGGGCCGCTGGGCAGCGGCCACCACCACGGGCCGGGGCCTGGGG
AGCCGCACCCCACCTACACGGACCTTACCGGCCACCATCCTTCTCAGGGAAGAATTCAGG
AAGCACCCAAGCTCACCCACCTGTGA
tagtgggcttggggctacgcgccaggagagtctccccccacccaccttttttctttggtt
gcttttttttttttttttttttaggttcttcctgccctttccttccttccttttctctct
tctccgccccgcactccgtttcccggtttcccccctcgttggtaaggcgtttttatagtt

Exon  5 +      22086      22280   1   Internal    195    53    Marginal
ttggcattctctgaatttatttcctctccttcccccacccagctttctttttatggcccc
agggggagggggagagagcaaggagatcggtatctttgtaataaaactgcaattttataa
atttttcatttgatgttgtaggagctaaatattacatttccactcctggatttaagatag
GGCTGCTTACTGACTGGCTAGAAGAGGCAAAAGAAGGCACAGTAAAGGGAAATATTTTCA
TCTTCAGATTTAAGGATTCCTCGAGAAAGGAATCAAATTCAGAAAATGCAGACCTCAGAC
CTGCATCCCCATCATCACCCCCTTCAGAGCTAGAAGCGAGGAACTGCTTTCGTCTGGGGA
TCAGGAGCATCGGAT
gtgagaaataaatccctattctccctggattgtatctttcagagacagaagtggaaaatg
tcgccattttgtttgcaatccaaaatatccatcatcatggcctttatcttccccctgtga
agctccctcagattatccttagaagcaggcactggagccatttctgggtacctgctgggt

--------------------------------------------------------------------------------