--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23921 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1305       1436   0    Initial    132    89        Good
caggcgcatcacgacaccggcgcgtcacgcgacccgccctacgggcacctcccgcgcttt
tcttagcgccgcagacggtggccgagcgggggaccgggaagcatggcccgggggtcggcg
gttgcctgggcggcgctcgggccgttgttgtggggctgcgcgctggggctgcagggcggg
ATGCTGTACCCCCAGGAGAGCCCGTCGCGGGAGTGCAAGGAGCTGGACGGCCTCTGGAGC
TTCCGCGCCGACTTCTCTGACAACCGACGCCGGGGCTTCGAGGAGCAGTGGTACCGGCGG
CCGCTGTGGGAG
gtgcgatctcggggcagggccgggaggcgcccgaaagcccggcggtgggagtaggggagc
ccgggccccccgcagacttcttcccctgggcgtctccgagctggggcccgcaggaggtta
aaggtcaacgggcttgggggcgccggcttgggggacgggggaacaggagcaccctggagg

Exon  2 +       3001       3186   0   Internal    186    99   Excellent
gcccaggtgcacagatcgccctggcagttgacctgtcatcagcaagttatctgtcctttc
tgccaagaatccccgctatgtgtcagggcttgtgctaggcctgggggcacagccgtgcag
cacactggtcctggacccttttgggggcctaggagctgagcccggctcttctctccacag
TCAGGCCCCACCGTGGACATGCCAGTTCCCTCCAGCTTCAATGACATCAGCCAGGACTGG
CGTCTGCGGCATTTTGTCGGCTGGGTGTGGTACGAACGGGAGGTGATCCTGCCGGAGCGA
TGGACCCAGGACCTGCGCACAAGAGTGGTGCTGAGGATTGGCAGTGCCCATTCCTATGCC
ATCGTG
gtcagtgcggccaggagcaggcagggcgggtgggggggcacggctgctgaacagcatggg
acctccagctgccacccacggcatgtatgctggggtgggatggtggggggtcctgccctg
ccctgccctgggggctgtgccctgtatagggggataggtagcctgatctaccccattggg

Exon  3 +       3499       3687   0   Internal    189   100   Excellent
ggctgtgccctgtatagggggataggtagcctgatctaccccattgggatgtcattcttc
ccgtctggctggaaggccccggagccccatgctgcaggttatgtgagggagtgcccgata
gtagggcgcctcctcatgccctgacctgcagccccctccccgtatctcctgtgtctgcag
TGGGTGAATGGGGTCGACACGCTAGAGCATGAGGGGGGCTACCTCCCCTTCGAGGCCGAC
ATCAGCAACCTGGTCCAGGTGGGGCCCCTGCCCTCCCGGCTCCGAATCACTATCGCCATC
AACAACACACTCACCCCCACCACCCTGCCACCAGGGACCATCCAATACCTGACTGACACC
TCCAAGTGG
gtaccatcctgcctccattgcacacacccaccttcccgccccaccctgtggtcttcctgg
tagggactgggtggccttcacagagtggaggccttggatctggggaggccagggaggcct
gtgagctgaggtcaggggacccagagcaagggcccagcaaaccacagtcctcccatccta

Exon  4 +       3894       4011   0   Internal    118   100   Excellent
cccaccttcccgccccaccctgtggtcttcctggtagggactgggtggccttcacagagt
ggaggccttggatctggggaggccagggaggcctgtgagctgaggtcaggggacccagag
caagggcccagcaaaccacagtcctcccatcctaggtatcccaagggttactttgtccag
AACACATATTTTGACTTTTTCAACTACGCTGGACTGCAGCGGTCTGTACTTCTGTACACG
ACACCCACCACCTACATCGATGACATCACCGTCACCACCAGCGTGGAGCAAGACAGTG
gtgagggcttctggtaggatcctctcagcggggcccagggtggctctgtttgttccctgt
ttggaaagctctcccaggaaaaaggtgctcccagcatctctacaccctcacagattccct
tccacctatgaagctaaaattcagcctgtgtgagcggatacgggctcccaaaatcacccg

Exon  5 +       4269       4331   0    Initial     63    47    Marginal
gaaaaaggtgctcccagcatctctacaccctcacagattcccttccacctatgaagctaa
aattcagcctgtgtgagcggatacgggctcccaaaatcacccgtgtggttgacctcgcta
ggagaagaggggtctggcctaacgtcacacagctcggggtggcaatcctgtcccttctct
ATGGTGCTACTCTCACTCCATCTCCCCTTGCTACACATCGTGCTCAAGGAACAGGCAGCT
TCG
gtggggggggcgccgggcatggtggcttatgcctgtcatccagcactttgcaaggaggcc
ctggtataaggatcacttgaggccagtagttcaagagcagcctgggcaacatagtgaggc
catcaccacaaaaaattaaaaaattagccagggatggtgatgtgtgccggtagtcccagc

Exon  6 +       7208       7395   1   Internal    188    92   Excellent
ctgcactccagcctgggggacagagtgagactccgtctcaaaaaaaaaaaataagaaatt
aaatttaaaaaaagcaacagaaacaaatggctgcctggcagcggtggctgcagggcgctc
ctgtttgtgtgactcaggtcgtgtccctccctcagccctggtctctcttgtttcttgcag
GGCTGGTGAATTACCAGATCTCTGTCAAGGGCAGTAACCTGTTCAAGTTGGAAGTGCGTC
TTTTGGATGCAGAAAACAAAGTCGTGGCGAATGGGACTGGGACCCAGGGCCAACTTAAGG
TGCCAGGTGTCAGCCTCTGGTGGCCGTACCTGATGCACGAACGCCCTGCCTATCTGTATT
CATTGGAG
gtaatggtggtttgggacatgcctaagggaggtcttttgcccccatgtggtgaccctggc
ttcagcaggagcccaagacaggtggatgggcaggcatggtcctctgagctttctgatgtt
tctcacccttggtgggaggcccattttcttttttttttttttttttgagatggtctcact

Exon  7 +       8339       8491   0   Internal    153    96   Excellent
tgttttgaagggcaggttcccagggtcagccagggtagggcagaacctctgattgctgca
tctctgcttacaggcccagaggcagctgctggggtgcacgaggggccttcctgctggagg
gcaggccggatggggctcaggctgtcggggtgctcacacctggtgctttggctgtcatag
GTGCAGCTGACTGCACAGACGTCACTGGGGCCTGTGTCTGACTTCTACACACTCCCTGTG
GGGATCCGCACTGTGGCTGTCACCAAGAGCCAGTTCCTCATCAATGGGAAACCTTTCTAT
TTCCACGGTGTCAACAAGCATGAGGATGCGGAC
gtgtgttggggctcctgggtccttgtcggggctgcttctggtcaccctccactttcgcct
tccctgtgtcctgcagttgagggcagctcagggcaatgaggcaaatggctccaaatggag
agggggctcatggggtggctctccagggtcctggctctcagaggaagtgcagcttcgaca

Exon  8 +       8706       8884   0   Internal    179   100   Excellent
cttctggtcaccctccactttcgccttccctgtgtcctgcagttgagggcagctcagggc
aatgaggcaaatggctccaaatggagagggggctcatggggtggctctccagggtcctgg
ctctcagaggaagtgcagcttcgacagggacaggggtcacttggctctgctatctcctag
ATCCGAGGGAAGGGCTTCGACTGGCCGCTGCTGGTGAAGGACTTCAACCTGCTTCGCTGG
CTTGGTGCCAACGCTTTCCGTACCAGCCACTACCCCTATGCAGAGGAAGTGATGCAGATG
TGTGACCGCTATGGGATTGTGGTCATCGATGAGTGTCCCGGCGTGGGCCTGGCGCTGCC
gtgagtctctgctgtgcacctgctccgcctgcccagcccgggggcgtcaccgtgaccctc
tgtcccttccctcctggcccgcaggcagttcttcaacaacgtttctctgcatcaccacat
gcaggtgatggaagaagtggtgcgtagggacaagaaccaccccgcggtcgtgatgtggtc

Exon  9 +       8969       9115   2   Internal    147    95   Excellent
cagccactacccctatgcagaggaagtgatgcagatgtgtgaccgctatgggattgtggt
catcgatgagtgtcccggcgtgggcctggcgctgccgtgagtctctgctgtgcacctgct
ccgcctgcccagcccgggggcgtcaccgtgaccctctgtcccttccctcctggcccgcag
GCAGTTCTTCAACAACGTTTCTCTGCATCACCACATGCAGGTGATGGAAGAAGTGGTGCG
TAGGGACAAGAACCACCCCGCGGTCGTGATGTGGTCTGTGGCCAACGAGCCTGCGTCCCA
CCTAGAATCTGCTGGCTACTACTTGAA
gtgagtgctccctccctgccctcggctagagtgggaaggagaccctggcaggtggctggc
ctcggtgggcatgtgctgttcaagatcggcctcgtgtccagcccaatgggaaggccgtcc
atacccagatagttcaggggaccaaatatctacccacccaaattgtggttttcttttttg

Exon 10 +      13044      13128   2   Internal     85   100   Excellent
ctcctgacctcaagtgatccacccacctcggcctcccaaagtgctgggattacaggtgtg
aaccatcgtgcctggccccgtgttgtgttctggcggtggaagatgggacagagaggatgg
gagggtgtctgagccattcctggactgatggaacctgtttcttctgccttttgtggacag
GATGGTGATCGCTCACACCAAATCCTTGGACCCCTCCCGGCCTGTGACCTTTGTGAGCAA
CTCTAACTATGCAGCAGACAAGGGG
gtgagcctgggggtccccaccccacttctccctgcctttgcctgggcttgtcctgaagcc
tggtcatgggaacagccaggaagaaccatgcgctgccagtctgggttttatttcattttc
ttttttacttaaaaagatagagacagggtcttgccatgttgcccaggctggtctccaact

Exon 11 +      15535      15679   2   Internal    145    99   Excellent
ggtcttaagccatcctcctgcctcagcctcccagagtgctgggattacatcccccttacc
ttctctgccagaggagcccccgcagtgtgtgaatgctgagtcatgctgtctactgagtgc
tgaacgggctctgctgctctggtcctaggctccgtatgtggatgtgatctgtttgaacag
CTACTACTCTTGGTATCACGACTACGGGCACCTGGAGTTGATTCAGCTGCAGCTGGCCAC
CCAGTTTGAGAACTGGTATAAGAAGTATCAGAAGCCCATTATTCAGAGCGAGTATGGAGC
AGAAACGATTGCAGGGTTTCACCAG
gtaagcagtgttgagctttctgcttgtgtgttctctcagggcagagatgtcactcacctc
ctccagcctgacctgcgcccactgcactgctcccctcgcttcagctttgggctctcctcc
cacggccccgtccacgttccctcaccgccaacagccaggcctgtgccccactcacttggt

Exon 12 +      18952      19087   0   Internal    136   100   Excellent
tttattctgggttacatcattccctggctgtctttaccccagcatcagtgagtcctgcag
tcactatagccccctgtgaagacagatattttggtcaccatcaagtggatctttattttt
atctaacatttacaattctgccagttctgactcttacattctctttgccttgaatcctag
GATCCACCTCTGATGTTCACTGAAGAGTACCAGAAAAGTCTGCTAGAGCAGTACCATCTG
GGTCTGGATCAAAAACGCAGAAAATACGTGGTTGGAGAGCTCATTTGGAATTTTGCCGAT
TTCATGACTGAACAGT
gtaagtggcagtttggctcatgggataacgtacccgtcctcattttttcaggttgccttt
ccaattctggccatttcaattgtaagaatattggaaacaaagttggggaagctggtttaa
tccatgtaggttgcgttgagaattttctaggaaaagtaagttgtgtttaggaagtaggaa

Exon 13 +      22347      22458   1   Internal    112    60    Marginal
ccaggaggttgaggctgcagtgagctatgattgtgtcaccgcattccagcctgggcaaca
gggagaaaaaagaaaaaaaaagacatttctatttagtgcctaccttagctccagactggt
tctaacttgacccatcagaagacatctgaatcgctttgtgtcttttttttttttttgtag
CACCGACGAGAGTGCTGGGGAATAAAAAGGGGATCTTCACTCGGCAGAGACAACCAAAAA
GTGCAGCGTTCCTTTTGCGAGAGAGATACTGGAAGATTGCCAATGAAACCAG
gtatccccactcagtagccaagtcacaatgtttggaaaacagcctgtttacttgagcaag
actgataccacctgcgtgtcccttcctccccgagtcagggcgacttccacagcagcagaa
caagtgcctcctggactgttcacggcagaccagaacgtttctggcctgggttttgtggtc

--------------------------------------------------------------------------------