--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (115354 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (22 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1863   0     Single    663    85        Good
ggcccgagtggcggccgggcgacgagtgcgggcctcggagcgactgcagcggcggcggcg
gacgcggcctgaggcgagcggcggggcgtggggcggtgcctcggcccgggctcgccctcg
ccggcgggagcgtccatggcccccgggcgccggcggggcgcggccgcggcctgaggggcc
ATGTCCGGGGTGGTGCGGACCCTCAGCCGCTGCCTGCTGCCGGCCGAGGCCGGCGGGGCC
CGCGAGCGCAGGGCGGGCAGCGGCGCGCGCGACGCGGAGCGCGAGGCCCGGAGGCGTAGC
CGCGACATCGACGCGCTGCTGGCCCGCGAGCGGCGCGCGGTCCGGCGCCTGGTGAAGATC
CTGCTGCTGGGCGCGGGCGAGAGCGGCAAGTCCACGTTCCTCAAGCAGATGCGCATCATC
CACGGCCGCGAGTTCGACCAGAAGGCGCTGCTGGAGTTCCGCGACACCATCTTCGACAAC
ATCCTCAAGGTGACGCGCGCCCCCCGCCCAGCACCTGCACCCAGGTGGGCCGGGGCGCTA
ACCCCCGCCCCGGGCCCCTCCGTGGTCCGCCGCCGCGGGCGGGGACCCCTGGGGCGAGGA
TGCTGGATCCAGCCCCGCCTGCACCCCACTCCCCCCCGACCCATTCCCCGAGGCCTGCTG
GCGTCGTCTCTGCCCCACCCCGTCTCGCCCTTTTTGAGATGGGGTCTCGCTGTGTTTCCC
AGGCTTGAGTGCAGTGGCGCCCTCACAGCTCACTGCAGCCTCGACCTCCCAGGCTCAAGC
CCTACTCCCTCCTTAGCCTCCCGAAGTAGTGGGATTACAGGCGCGCACCACCAGCCCAGC
TAA
tttttaagtttttttttgtagagatggggtcttgctgtgttgcccaggctggtctcagtc
tcctggcctcaagtgatcctcctgccttggtctccctcaagtgctgggattataggcatg
agtcatggcgcccggtctgcctctgccctctctagggtgcctggggaccgtgggagtggg

Exon  2 +      12442      12498   0    Initial     57    47    Marginal
tgccttttaatcctaaaagccgaatgtgaatatttgttgctgaccgtgtgatgggttagt
ctttctctctgtgaggataaatgctcaggtgtgtccaggttttgcagaatggaaaacatg
acttgtatcctgtgttagccgttagagaagctcatgcttctggttgattctgttgaccaa
ATGCATTTGGAACGTCTGCTTTGGAAGTGCGGCATCCAGAGGACAGAGAAGCAGAGG
gtgggagctcttgcaagcagctagaaaggtgctggagggcagcacatccagctgctctgg
acggcaaggggaagaaaacatccctgacccccactttcttaagtagagaccaagtagacg
gcacctctctgtgaacgtcagcatctattttactgtctagtctgaagtccacagcaccaa

Exon  3 +      15229      15396   0   Terminal    168    58    Marginal
agactgggagcagaggaagaaatattgagactcgtatgagcatgaacacagcacccaagg
caaaaagaagattctagggtgtgtagtgcatttcctgaccccagccccagtcccttaagg
tagtattgaggcaagaaagagccattgcaaccctaaacattctgacaccttcccatctag
AAAGAAACAGACCCAGAGTCGGGAATAGAAGCCGGGGAAAAGTTCGGGGAGAACACTCAA
AAGGAAAGGGTCCTTGGTGGAGCCAGGAAGTGTGGAGGCACCCAGAGCTCTGTGCTGACC
ACAGCTCGAGGCAGGAGTCCACTGGAGGTTGGGACACTTACTAGCTAG
caggagaaaatccactagccccagacaagttcccagctctcatcatctccctttcctcag
acagggattgaaagcagtgtctgtctgtcaaactctagctctggtccaagaagacaaacc
aggtagaaacagaatcaggaaaaactggcctcgagcacgtctgagaacaggctggtggag

Exon  4 +      15590      15686   0    Initial     97    64    Marginal
actagccccagacaagttcccagctctcatcatctccctttcctcagacagggattgaaa
gcagtgtctgtctgtcaaactctagctctggtccaagaagacaaaccaggtagaaacaga
atcaggaaaaactggcctcgagcacgtctgagaacaggctggtggagggctaccacaggg
ATGCTGGAAAGGGACGACATGGCAGCTCCGAAACACCGTCCCAAAAGAAAAGAGGGCGAG
AGGAAAACTAGCACACAAAAGTCAGATGAAAAACAGG
gtaagaagagaaactatgaaagagaagtagcctgttcaagagtgctctatattgtataag
aataataagcatatagatgatataaaacaagagctccagggtatgagaaagcattaacat
gagatgcacagggaaatggcagaagtaatagattgaaaactcagcatcgtcatagatctc

Exon  5 +      20924      21178   0    Initial    255    45    Marginal
catcattggaaacaaatgcttgccatgtagagcttacattctagtgtgggaaacagacga
tccacagggtaaacaggcacgtcttatgaaatgttagaaagcaacaagtgctgggggcag
gagaaagcagggcgagagcgtgtccatgtcaggggtggcagggagccgcctgcagaggtg
ATGGGGAGAGCACCCCAAGTGCAGAGGCCTCCGCAGACCCAGAGGAGCCAGTGTGATGGC
TGTGTAGTGAGGGAGGAGACCCCTGGATGGGCAGAGGCGGGTGCAGGCCACTGGGAAGAC
GCGGGCCTTAACTCTGTGTGTGAGGGGCTCTTTGTCCCTGAGGATTTCTGCAGAGGAGTG
GCAGGATCTGACTTGGACATTCACGGGGTTGCCCTGGCCACCCTCACTGAGGGAGACCAG
GTGGACGTGGGGGCA
gtgagaggctgtcatcctgatctgtgggaccagcgtgttaggagtggagatgctgggaag
cggtcagatcctagaaatgttgtgaaagtgttgatgttgaaaataccatttttgagacag
gcagacatgggtgtgatctgttcaactggaaaaggagtcaactatcttttaggaaccatg

Exon  6 +      31843      31895   1   Terminal     53    71        Good
tacgctgtttcctgctcctccagctgcactctgacagctcacatggggcgattgcctcca
tttccattttcatttccttcacagattggtttgctcaccatccagcatgtttgtttgttt
ttttttccccacctgagagctctcccggaatgtccccagcctctccctctggaggtatag
CAGATATTGTGGTGGCTTCCTGCAAGGAGCGCTGTGCTGGCATCACTCAGTGA
tgtccccttacgcaagctacactgactgggaacttctgttccctctggggaaggggaggt
aggaggagactctcccctggatgccccttaataaccagtgaaattggtactatgggcatg
gagtcatctattttttaaaataatttaaatgaaaacatgactgtggagaaagccggtttc

Exon  7 +      36850      37009   0   Internal    160    70        Good
ggagcagcaggaagtagggaaattgtagctgtctctggaaggtagaaccacggcattggc
tgacaggctgggccagacctcaggatggtgcatctcccctagctgcaggccgctgctgct
ctgtggggagtgaggtcctcctgtgcggcccaggtccctctccatcccatccaaattcag
GCCCACAGGATGGTCCAGGGTAACCCACAGCACCTGGGCACTCTCCTACTACAGCCAGTG
GCCAGCCTGCAGGGACAGACAGCCTCCAAGGCCACAGTCAGCTCGGCCCACACCCTTGCT
GATCTGCAGAAGGTGCAGAAGCAGCTTTTCAGGCAGCATG
gtagcagggcctgggtaggccagctctggcttaacccaagtgcaggccgtaagcactgaa
ggcgctgctctaggtgggtgtcgggtagcactactcatgatggtcactgcttacaggagg
gagttgggtatgcgtgagaaggaaacatgttcacagattcccgaaagagatattgaaact

Exon  8 +      38446      38705   1   Terminal    260    46    Marginal
tgaagcaaatagatcaactaaaaaacaatttgggggaaaataaaggaaaattaaaagtta
ttaaacataaatgtgtaaattggcagaacctttctggaaaacagtttagtaatatttatc
aaaacctcaaaaatgtgtgtatacttttttgacccagcagttttataattcaacatctag
GAATTTGTCACAAGAAAATAGCCATATATGTGAAAATAGGGATGTATCAAGGAGTTCCTT
GCATCGTTGTTTATTCTTTCCATACACTGGAAAGAATTCCGATGTCCAGCCATAGGGATT
ACCTCAATCTTAGCATGTCCCACATGTCGGACTACTCTGCAGCCATTACAGATCTTGAAA
TCTTGAATGACATAGGAAAGTGTTTACGATACATCGCTAGAAAAATTTTAAAGTGTTACA
AAATGTTCTGTAAAGAATAA
gacagataacattcctagatgttaataagttatttctagatagtgatatttttaaggatt
taattttcttctttatgtatttctatatttcctctattttttgcactaaaaatacacttt
tataatcagaaaaagacaagttctttcttcttttttctttttcttttttttttttttttt

Exon  9 +      49728      49833   0   Internal    106    61    Marginal
tacacttcattttccagtgaaattttctgaaattgttgccacctcctccccgcccagttg
tcttttttccagtagctttgcaaatgaatgatagcagaaagcagacttctttctgtggtg
cttatgtacatctgttttcttttttttcttttttcttttctttttttttttttgaaacag
GGTCTTGCTCTGTTGCCCAGCCTAGAATATAGTGCAGCAATCATAGATAACCGTAGCCTT
GACCTCCTGGGCTCAAGCAATCCTCCCCGCTCAGCTGAGACTACAG
gtgtgccaccaccaagcccagctgtttttaatttgatttaattttttgtagaagcagggt
cttgctctgttgcccaggccggtctcagactcctgtgttccagcagtcctccctctttgg
cctcccaaaggggaggctcacagtgtgagccactgctctcggccatgtgcgtctgtcttg

Exon 10 +      50280      50424   0    Initial    145   100   Excellent
gtgagttttctgcgttatgacaatggatgcccattttgagcttctctagcgtggtttagt
ctttggaatgcaattaaatcctctcttctttcttttattttctagggctcaagggttctt
gttgatgcacgagataagcttggcattccttggcagtattctgaaaatgagaagcatggg
ATGTTCCTGATGGCCTTCGAGAACAAGGCGGGGCTGCCTGTGGAGCCGGCCACCTTCCAG
CTGTACGTCCCGGCCCTGAGCGCACTCTGGAGGGATTCTGGCATCAGGGAGGCTTTCAGC
CGGAGAAGCGAGTTTCAGCTGGTGA
gtgagtaggccttcttgctgggcacctgatagtgtgttttttacatgactattttggacc
gttagttgaatttccttaaaaactgtgtaacagtccaagcaagctctaaatcaccgtaag
ttgtaatgatcaacaaccaaaacacgggatggaggcagatgctatataaaaggctcaaga

Exon 11 +      55577      55673   2   Internal     97    76        Good
gcgctttgtgagccaaaaactgacacaggcggtagctttatgtgcactgtgagctatttc
tctgccctttcctgggctttcctgggcttctctgtgctggttcctttttggcctggcttc
ctctgtggctgcaaaatgatggcagcagaatgaggcctcacacacacacatcaccaccag
GAGCAAGGAGGGGACCTGGCACATGGCCAGGGAGATGCTGTGCGTGGTTGGTTTAGGCAT
GGATGAACTCTGGATCCCTGTCCTCACCACTGGAGAA
gtaggggccgcctaactggagcagtgggtgggatgttgccacccggtctgtgtgctgtaa
ggtgggtgcaggcaggtctcagaggtcacagcgttctctgcggccacatgtaccaagcag
tttgaactcacctatggggagtagtgaggcaccactgaggtgtcagagcagtaaatcaca

Exon 12 +      57737      57789   1   Internal     53    57    Marginal
gtttagcatagccgtgggactgagtgctgggccttgctgtaggggcgaaatgacacttac
ccccggcctctcccccttcccgatgcctggccagtgtcaagaatctgagcagtcagcgtg
gacccacaacggaagcggccttcagcctgtcttgtttaagcctctgtgtcttggctttag
CTCTCACCAACGTAGCTTCCCAGAGTGGCGTTTCCCGGAAAGCTCAGAAGATG
gtgggtgcctgggggaagggagaagagtgttgtagctggaagaatggcaagcgcagaggc
ccctaggcgggagcaggcttcgtgctccagagtgcagcagggaggctgacgggaggtggg
ccagagcggtgggtgacaggcgacagctcgtggtgcctgtggaggggcgcctgagggctg

Exon 13 +      73288      73405   0    Initial    118    56    Marginal
aacaggtttgtgcaaatcttttgccctgttgggttgttggtcattttcttgggaattctc
gatatgagtcctttgtcagattatccggaatatgtaaagaactctcaaaactcaagaaaa
caatttttttaaaaggacaaaagatttgaacaaagaagagattcctgaagcaaataacac
ATGAAAAGATGCTCAGTCGACGTCATCAGTCATGACACACATGCAGTTGAACACCGTGGT
GAGACACCACATGCTCTCCTAGGAGGCTGCCCTTTGGAAGGCGACCACCCAAGGCACA
gtgagggcgggggtgggaactcgggctctcacacacccctggtagaaatgtgaaatggta
ctcctgctttggaaaagcggggcactttcttaaaagttaaacatacaattatcacatgag
ctagcccttccacatgtagatatttaccaaagagaagtgaaaatatttgtccacacaaag

Exon 14 +      82439      82503   0   Internal     65    98   Excellent
agggagccccggtctgcgtcctggaggaacggcacgctgagtcctgggccagtggccggc
ggggctgttggcgaccacagtagcacacaagggctctttctgaggagcaggagaccctgg
cacgggccccacgggagtgtctggggcgtccccgcctgtggcctcttctccccgccgcag
CACCAGTGGCTCCACGAGCAGGGCTCGGAGCTGGCCCTCTCCTGCTTCGGAGCCGCGCTG
ACTGG
gtgtgtggcggatgggaggccgccctgagtgctcctcctcccttttgtacagcctgggtg
gaaaggacgggcctggtgcacttcctgcgggagggaggacatggggcctgcttccctctg
gcgctcctccacccgggcagcgtggtttctttccaaatgatttatcctctcatcgtcctg

Exon 15 +      83217      83318   2   Internal    102    80        Good
ccggccccgccatgtgcaccttctgtgacgaccctaagtcagggtggtgtttcctagcag
tgcagaacacgaagcccttacaacttctcctagaaacgaagcctgggttgacccctccac
ctcagggtgagagcttttggtattttgagtcagtatttttggcatgtcttgttttcacag
GTTTCTCTGCCGCTTTCGCTTTTTTCTGGAGGGGCTGGAGGTAGGGACAGTAATGAAGGT
AAGGAATGCGGATGGAGCCGCAGTTCTCTGCGAGTGTTCTGT
gtgagtgctgggaggcctcggtgaggttaggctgtggtgctgggtggactggtgggcggc
tggacactccacatttttcccttacatttggacattccgtggatacgacagatgggaaaa
ctggaccagctggaagccgaattttacgttgtgacctaaagagctgttaggtactcagca

Exon 16 +      85954      85998   0    Initial     45    51    Marginal
actattctggtatttggctaattattcctttccttttacttgtctttttaccacctattc
ctaaacagtagtaacttaccacttgggcatgttatttaaccactttgtctcagtcttccc
atctgtcacatggacagaacagtaataacacaccgtgagtattgtgagaatgaaggtgat
ATGGGGGAGGCCCTTAGAACAGTGCAGGCACATAGGAAGTGCAAG
gtaggtgtgagttcttacagctagcgctttgtttccttttgcctgtgttttaacttcatg
taaataaggacagtataaccattttatgacttatttcttcagcgttatattttgagatcc
atcatggggtttttatttttattttatttatttatttatttatttatttatttatttatt

Exon 17 +      90172      90349   2   Terminal    178    91   Excellent
tgattgatacacagatttgacacaattcctgtgaaaatcgcagcaagatcttttgtagac
atggatgtgattattgtaaaatgtatgcggaaaggcactggaatggccaaaaatgtttga
aaaagaataaagtgggaggggccactctccctgattccaaggcctgttgtctccctgcag
TGGTCAGGCCTGTGTGGTGCTGGCGCAGGGAGAGACACGAGGTCACTGGACAGACCCGTG
GATCGCTCCCCGCCAGCACGCCCGACTGATTGCAGCCAAGGGCAGAAGCAACTCAGTGAA
GAAGGAGAGCCTTTTCAACAAAGGGTGCTGGACTGTCTCTGTAGGGAAGAAAAAGTGA
accttgacctaaatctcttatacaaaattaattcaaactgagttacagatttcagtgtaa
agcgcagaactctaaaacttgagagaagataacagtagaaactccttggggcctagaact
tggtgaagaattcttagacatgacgccctagtgatccgttgaaatcaaattttgagaaac

Exon 18 +      97991      98099   1   Internal    109    62    Marginal
ttgagatacgtcccatcaatacctaatttgttgagagtttttagcatgaaggttgttgaa
ttttgtcaaaggccttttctgcatctactgagatagtcatgtggtttttgtctttggttc
tgtttatatactggattacatttattgatttgcatatgttgaaccagccttgcatcccag
GGATGAAGCCCAACTTGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGGTTTGCTTT
TCCAGTATTTTATTGAGGATTTTTGCATCAATGTTCATCAAGGATATTG
gtctaaaattctcttttttggttgtgtctctgccaggctttggtatcaggatgatgctgg
cctcataaaatgagttagggaggattccctctttttctattgattggaatagtttcagaa
ggaatggtgccagctcctccttgtacctctggtagaattcggctgttgaatccatctgct

Exon 19 +     102586     102666   0    Initial     81    80        Good
caggtctattattagaatgaatacagagcttagcagggtgactaggcacaagccaatata
cagaaatcagttgtatttctattcactagcaacaaaggattataaaatgggaaatgttta
aagatgccatttaagaagcaccataaaagattacatacctgagaataaatctaagggaag
ATGTGCATCACCTGTGTACAGAAAATTTATAAGCATTACCAAGAGGAATTAAAGGCCTCA
TTCAAAATCAAAACTCTGCAG
gtgtttgcggggacagggagggtagacattgacagctgactttagaactaatatggaaac
gcaaagggccggcgagactcagtgctttcttcactttgagcaccaaagtaagcgaggaca
gagatgaattacagcccctggaaaatgacggcgtctgtgagtccatgtggacagcgatga

Exon 20 +     105148     105462   0    Initial    315    45    Marginal
tcttcttatgaaggcactatcgtatcatgaggtccctaccttcagtcacctcccaaagtc
cccatctccaaataccatcacactgcaggtagggcttccacatgggaattctgggagcat
acaaacatgcagtctataatgatgatacaaatagaaccacctagaaaagatcaccaggaa
ATGCCAGAAAACCCAGAAAAGATCACACTGGAGTGCCATTTCACAGCTAGTAGGATGGCC
ACCGTTTTTAAAAATCAGAAAACAGCAAGTGTTGGCAAGGATGTGGATAAATTGGAAACT
TTGTACATGGCCCATGGGAATGTAAACTTGTGCAGCCGCCGTGGAGAACAGCTTGGTGGT
CTTCAGAAAATTAAGCACAGAATTACCAAAGGACTGCCGGGCACAGTGACTCACACCTGT
AATCCCAGCACTTTCAGAGGCCAAGGCGGGCGGATCACTGGAGGTCAGGAGTTCGAGACC
AGCCTGGCCAACACG
gtgaaacccccgtctctactaaaaatacaaaaattagccaggtttggtggcgcacgcctg
taatccagctacttgggaggctgaggcaagagaactgcttgaaccaggaggcagaggttg
cggtgagccaagatcgcaccactacactcagcctgagcaacggggcgagactccatttta

Exon 21 +     111833     111883   0   Internal     51    96   Excellent
tttctttaatggtagtttttttattttagaaaacacacggacactctctgcctttttcct
ttgctttcccattcacacggaggcgaaatgccactgctcttaccctgttcagttcttgta
tttgccacatcaggattcctcagtccagactgagctgtgaatattcttccttcctgacag
GGGGAGTCGGTGAAGTACTTCCTGGACAACTTGGACCGGATCGGCCAGCTG
gtgagtaagcacgcccgcccgaagaagctgggctccagggttagaaaacatgtgtccaga
gaccaaagcagtccacgttgtgaggactttggctggactgacaggccgagcttgttctgt
cacattaccacgaatagtactgtaatggcacgctctcacttggatctgggccccgtctca

Exon 22 +     113586     114155   0   Terminal    570   100   Excellent
gattctttctgtttcacggccagttgataatgttataaatgaaatttgcttttggtttct
ggttcaacctgttgcaaaagtcagtctctttccttcttatctttttgccatctttttgtt
tctattttctctgttctttcttcctccccctaaatttctgcctcatcctgtattttacag
AATTACTTTCCTAGTAAGCAAGATATCCTGCTGGCTAGGAAAGCCACCAAGGGAATTGTG
GAGCATGACTTCGTTATTAAGAAGATCCCCTTTAAGATGGTGGATGTGGGCGGCCAGCGG
TCCCAGCGCCAGAAGTGGTTCCAGTGCTTCGACGGGATCACGTCCATCCTGTTCATGGTC
TCCTCCAGCGAGTACGACCAGGTCCTCATGGAGGACAGGCGCACCAACCGGCTGGTGGAG
TCCATGAACATCTTCGAGACCATCGTCAACAACAAGCTCTTCTTCAACGTCTCCATCATT
CTCTTCCTCAACAAGATGGACCTCCTGGTGGAGAAGGTGAAGACCGTGAGCATCAAGAAG
CACTTCCCGGACTTCAGGGGCGACCCGCACAGGCTGGAGGACGTCCAGCGCTACCTGGTC
CAGTGCTTCGACAGGAAGAGACGGAACCGCAGCAAGCCACTCTTCCACCACTTCACCACC
GCCATCGACACCGAGAACGTCCGCTTCGTGTTCCATGCTGTGAAAGACACCATCCTGCAG
GAGAACCTGAAGGACATCATGCTGCAGTGA
gcgaggaagccccggggtttgtcgtcgttgagcagcccccacggctgtcggtcagactct
tgggtgtgtgttgtctgtgtggtccttgagtgggtttctcggatccgtgccctggaatac
ctggctcaggaatgctgtcagaccagccagccagcgagctctaggcaaaaggacatggaa

--------------------------------------------------------------------------------