--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (41862 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        346        585   0   Terminal    240    48    Marginal
atttcaacattttaataaaaatctaaataaaaataaaagtaaaacttaaaatgatttttc
acatttaaagatattaaaataaattcaaaattgcctagtaaaataaaagccaaataaatt
ataattaatatcaaatcttgaaataaaagtgtttaaaaatataattgttcaatattgcag
AAGGTTCTTAAGCAACCCACCCTGCTCATGTTGAATTGTAAGTACTTCTCCAGAACTGCA
CACTGGAACGGGAAGAGAAATAACATGGACTTTCACACCATTAGGAAAGGAGACTTCATT
ATACTGAGCCCGTCTACTCCTGCACACTCCTGGGGTGGGATTGTGGGTCACAGGGAGACG
TACGTGCATACTGCCGAAGAGCTCCCAAGTGGCTGGCTGCACCAGTTAACACTCCCCTGA

gcagtgtaggggagtctcagagggtcacttggcattttccatcattttcattttagccat
ttttgcaggtgtgcgcaatgctgtttttataaccaacacatcatttttctcttcctttcc
tggagggggaacccagcttttctaggccctccaccctttgggcaggaggaactgggtgtg

Exon  2 +       1577       1806   1   Terminal    230    46    Marginal
gtcgaatctgcggcggcgacccggcgccgcgtcacgcggtggtgaatgtgcggcagcacg
cgcgccgcgtcgtttacgcggcgatttcatcatgctccgagccgggcggcgcgcgccgct
tccgtcgccaccctctctggacagcccagggccgcaggctcatgccctctccgcgtccag
TGCTGCTTAGAGGTGCTCGCGCCGCTCTGCTGCTGCTGCTGCCGCCCCGGCTCTTAGCCC
GACCCTCGCTCCTGCTCCGCCGGTCCCTCAGCGCGGCCTCCTGCGCCCCGATCTCCTTGC
CCGCCGCCGCCTCCCGGAGCAGCATGGACGGCGCGGGGGCTGAGGAGGTGCTGGCACCTC
TGAGGCTAGCAGTGCGCCAGCAGGTACCGGTGTTTTGCGCTCTCCGCTAA
gcctccggctctcctcccagggccttcttctggtcatccttccctcctccccggggaact
gtcctcctcttcggttacccctttctttcccttcatcctctggcgtcttcttcgcctccc
ccactttggtcccaagtcccccgtgcgtcagccacctcctctcccgcggacctccgtcct

Exon  3 +       5432       5533   0   Internal    102   100   Excellent
tgatctcagatggtgaggagggcctttcaaagtgctggtattacaggcgtgagccaccac
gcttggcctgaattgcatcattcttacatagactttttaaaaggcacgcttaaaaacaca
ttcctaacatttcttaacttctgaaaccaatcctgaatataaattctctttcttggctag
GGAGATCTTGTGCGAAAACTCAAAGAAGATAAAGCACCCCAAGTAGACGTAGACAAAGCA
GTGGCTGAGCTCAAAGCCCGCAAGAGGGTTCTGGAAGCAAAG
gtgagtcctgggatgctaaaataggaacataagtaggtataggattgttcatctttaatt
tctttggatgggagagacctagaaaagtttctgaacaagtatcatttggtttatctgttt
atccataatgccgccttctcctttccctctacctggtagactcctcatcctttcaaaatg

Exon  4 +       5693       5834   2   Terminal    142    46    Marginal
aagagggttctggaagcaaaggtgagtcctgggatgctaaaataggaacataagtaggta
taggattgttcatctttaatttctttggatgggagagacctagaaaagtttctgaacaag
tatcatttggtttatctgtttatccataatgccgccttctcctttccctctacctggtag
ACTCCTCATCCTTTCAAAATGCAACTCAAAATGTCAACTTTTTAATAAAGCCTTCCTGAC
CCTGCAAATGCTGGACTCAATACGCTATATGAATTTCCATGGAAAGGATTGTGCTCTTCT
TTACGACTTCTCTTATGCCTGA
aaataatgatttttgtttgtttgtttgttttaaggaaaaggtctgtttatttgatacctg
ctcccagacctttcaaacaatagatctcccatcaccaaacttaagttgttttggggtttt
aaagtaaccattttgctatagcaatccactgacaattcaaatattgctttatattgctta

Exon  5 +       6583       6685   0   Internal    103   100   Excellent
tttatattactcaaagggaaaaaaagacctatggcttctattgtttttaacctatcaaaa
tcttgtctgtttgataaattttatatttaattctggtgaggaataaactaaattcagata
tataagttcagattcccacccacccctccactcactcactttttatttaatctctaacag
GAGCTGGCGTTACAGCCCAAAGATGATATTGTAGACCGAGCAAAAATGGAAGATACCCTG
AAGAGGAGGTTTTTCTATGATCAAGCTTTTGCTATTTATGGAG
gtaagggattaatgacaaaaagaactattgtgttgttagtggctctaatattatacttaa
atcaagaacatggcttgcctgttggtatccacttgtatcaggccacaaagcagaggatgg
atgttttgcttttgtttgcttggagtcaccatttggtgtgatacctgttatttttctcca

Exon  6 +       7695       7836   1   Internal    142   100   Excellent
gagcttttttattttacttccatcagctagctgaaagtaaggttcttcagtattgaggga
tttgcattgttgacttgaatacacttttagggagtataggtatcagtttctcatgtctcc
ttgccttcatttgttcagagtaacaaggtaaagtatgtgttttcctctcatattctatag
GTGTTAGTGGTCTGTATGACTTTGGGCCAGTTGGCTGTGCTTTGAAGAACAATATTATTC
AGACCTGGAGGCAGCACTTTATCCAAGAGGAACAGATCCTGGAGATCGATTGCACCATGC
TCACCCCTGAGCCAGTTTTAAA
gtgagatcttactttggagtgggggtatcctactttaaataaaataacttattaaattat
ttaatatacttatctaaataacttcctgattataaagaactactcatttcatgtagaaaa
tctgaaaaatatggaaaagcaaagaaatgtataccttctgctcacagatagctatgttaa

Exon  7 +       9670       9758   2   Internal     89    70        Good
tagatttgaggaagaattttctctggcatacattactgtcatggatacatcattactata
gatatgggagcttccatctttgagatggatataaatattgatggggaattatcttataag
gtaatatctatgtgtaatttgtatgagaatgacaaattgggttggcatttgttaatttag
GACCTCTGGCCATGTAGACAAATTTGCTGACTTCATGGTGAAAGACGTAAAAAATGGAGA
ATGTTTTCGTGCTGACCATCTATTAAAAG
gtgaggttcttcatctccttcaggtaggattgatcaaaataaaaggtttaaactttctct
cagatgtctttcattaaattttttattgaggcataacattcaaagagcaaagtgcacaga
tcttaagtatatagatcaagtcctttattttttaaaaaagttatatgtagataattagtt

Exon  8 +      12813      12919   0    Initial    107    43    Marginal
ccccgcattttcattaaaatttttttcaagaagctgagtcatttgttccttactgttttc
tactgtctggatttggctaattacgttattgtagtgaggttacacatgttcatctttttc
tctattagatttagaagcttgaccaggtatttttggcgagacatttggttaagtggtgtt
ATGGACTTCTGTCCAGAGCTACATAGTACCTGGTTAGCTCTTCTGTGGGCTGTGGCCATT
GATGTCCATTGTTTAGATGCATTAACTGATGAGGGGATTTCAAAATG
gtgatttttgtcattgttattctttttttttttttttttttagctagactatttctatat
gaaaaaactttctatcaactatttgatttaactgagacacgatttgtaaagaaaggtgag
aataagtgcttcatccattctcccaccccttgtctttttaaacctgttttccattagttg

Exon  9 +      12967      13034   2   Internal     68    79        Good
ggcgagacatttggttaagtggtgttatggacttctgtccagagctacatagtacctggt
tagctcttctgtgggctgtggccattgatgtccattgtttagatgcattaactgatgagg
ggatttcaaaatggtgatttttgtcattgttattctttttttttttttttttttagctag
ACTATTTCTATATGAAAAAACTTTCTATCAACTATTTGATTTAACTGAGACACGATTTGT
AAAGAAAG
gtgagaataagtgcttcatccattctcccaccccttgtctttttaaacctgttttccatt
agttggttccctaacatccttcagaaatgcacgagttcctgcctgccttttcgttttttc
ctcctactgttgtgaactttagattcaaatatttgatattcagtcagttgcagttatctt

Exon 10 +      13650      13706   0   Terminal     57    85        Good
taaaagataaacttttcatgagttaatatagatacttaatagttaacttaaagttaggtt
tatagggtttttactatattaatcttaaatctctctcctttacccttaccaaaaatcgca
gttctcagcaacaaaacataatgattgatgtgccttatctcccactgtatacgttaacag
TCTCAGAATGACAATACCAACACCACCATCAGCAATATGAATGTTGAAAACAGTTAA
aaacacttttattgttcttttctttagggatatgccagcactgtgtagtcttacagtctg
ataactgtatttaaagtcacttggagtcattctctctgtgtggttatgccatcagctaga
tatgcagttagtccatatatttcattttattttcagtattcagggtttcctttttaaaaa

Exon 11 +      13907      14078   2   Terminal    172    63    Marginal
tctttagggatatgccagcactgtgtagtcttacagtctgataactgtatttaaagtcac
ttggagtcattctctctgtgtggttatgccatcagctagatatgcagttagtccatatat
ttcattttattttcagtattcagggtttcctttttaaaaatttgttttataatcatatag
CACAATAGCAAAGACTTGGAACCAACCCAAACGTCCATCAATGATAGACTGGATTAAGAA
AATGTGGCACATATATACCATGGAATACTATGCATTCATAAAAAAGGATGAGTTCATGTC
CTTTGTAGGGACATGGATGAAGCTGGAAACAATTATTCTCAGCAAACTCTGA
caaggacagaaaaccaaacactgcatgttctcactcataggtgggaattgaacaatgaga
acacatggacacagggtggggaacatcatacacctgggcctgtcggggggtgggaggctg
ggggagggatagcattaggagaaatacctaatgtaaatgacgagttgatgggtgcagcaa

Exon 12 +      16222      16367   0   Internal    146    94   Excellent
aatggaaagtgaataaattggttatggttttaatgtgggtgtcctgaaggttaggttaat
tgtgatgttcctgaattttgtgtgattgtagcagtggatggctagggttatatataatac
tttatatcttatgccttgttttctctgtcttttacactaatttctttatatgtcttttag
CTTGATAACTATGGACAGCAAGAACTTGCGGATCTTTTTGTGAACTATAATGTAAAATCT
CCCATTACTGGAAATGATCTATCCCCTCCAGTGTCTTTTAACTTAATGTTCAAGACTTTC
ATTGGGCCTGGAGGAAACATGCCTGG
gtatgtatcacttattgtttacctgtttatgtaatgaagtttttaaaattgcttatatta
aaaggtaaatatcaatgttatgaaggaaaaatttttaaaaagtgatatacagaagtacag
atgaatgtattatggagaaataatggcagaaataaatcttttaaaaaattctttctgaat

Exon 13 +      21565      21632   0   Internal     68    71        Good
cgcctgtagtcccagctactcgggaggctgaggcaggagaatggcgtgaacccgggaggc
ggagcttgcagtgagccgagatcgcgccactgcactccagcctgggcgagcgagactccg
tctcaaaaaaaaaaaaaaaaaaattaaacctcttttgcagtgtatttcatgtatttttag
GATCCATTTAAGCAATTTTACATTACTCGTAAAACATCTGAGATAATCATGGAAGCACAC
CAGAAAAT
gtgatttttcttgaaagaagagagattgattttgactcataaaattaacttgaaacactt
ctcccgcaaatagctactaaattgcattcagagaaatctctttgggaaaccattactatg
tgcacttcatcgttaggtaattagcttgatgttagcttgttcaattcatgccttatatcc

Exon 14 +      22533      22695   2   Internal    163   100   Excellent
tttaattcaaaatttttttggccattcccttaggaaaccaactttctgtttagtgaaaaa
gaccactatagtatggagcctttatcactagaatgcagttgaaaatagaggccttgtttt
ttgtttgtttgttttttgtagttaaatatgcaggtttatcgcttacgtttttgctttcag
AGAATTCACAATGGCAGAAATTGAGCACTTTGTAGATCCCAGTGAGAAAGACCACCCCAA
GTTCCAGAATGTGGCAGACCTTCACCTTTATTTGTATTCAGCAAAAGCCCAGGTCAGCGG
ACAGTCCGCTCGGAAAATGCGCCTGGGAGATGCTGTTGAACAG
gtaggattctggaggtaacttaacttagattgtgcctgttcagggtttgcagcaattagc
aaattctatgtgttctgggtgacaagatattttattttggcagtcatttgcttttttaca
gtacttggttttgtacagaatttgttatacagtattattatagtaagagaaaaatcacct

Exon 15 +      23751      23938   0   Internal    188   100   Excellent
aaataaccaagatctcattctgagtatttgaaattgttttgaaagcaagataaaatagtt
tgtgttgggtgtcaaatatttttcagtagagtgagtcaatggaaaccgatatcttggctt
tgaagagtattaatgtgtgttttcttttcttcctccatgcttgcttattggttggtttag
GGTGTGATTAATAACACAGTATTAGGCTATTTCATTGGCCGCATCTACCTCTACCTCACG
AAGGTTGGAATATCTCCAGATAAACTCCGCTTCCGGCAGCACATGGAGAATGAGATGGCC
CATTATGCCTGTGACTGTTGGGATGCAGAATCCAAAACATCCTACGTAAGTGGAGTGCTG
TTTACCAT
gtgattttcacattgttaacttagaagcacaggtaccaaatgaatttttgtgcactttat
gtcacagaggaacaaagggaaaagaaaagagatcttttcctgagcaaaacagaaaaagca
gttgcctcctgcctttttataagtgtcctaaggagctcgttgtagtcttagatagctgag

Exon 16 +      27377      27461   2   Terminal     85    57    Marginal
caagcattcaattcattgcaggttctttgaaaataatttaaattttgctttttaaaagta
tcttatgtgtgtatttataagaaagggaacctggcatcaatgtgatcataatgctcttat
ataattttattgtgtgacctgaactttacccactcttatactgagttttcttttgttcag
TGAAGAAAGTGAATTGAATCCAAATGCCCACATTTATGGCCAGCTGAAGTATGTGTTTAG
TCAGCCATCTGATATCAAGTTGTGA
gaacactaggtacttcatctaaagaatagtggtttctgccaaattcattttgatttctgt
tcacaaatttgaaccaaatttacaggctttgtctaggttcacatttaatttccataatta
aattccagaatatgttagtttaccccacagactcagtataacaatataaatccatccaga

Exon 17 +      28028      28174   0   Internal    147    64    Marginal
tattagctgcctgatatatgaggctattcccatttcaaatatttatgaaatttgaatgaa
gattatatcatcgaattatcattgaatatatgaaaggtttataatctgcatgcatttgtg
aatgaacccaatataagtaataataagtaagtaatgtttttattgattatatctttttag
GGTTGGATTGAGATTGTTGGATGTGCTGATCGTTCCTGTTATGACCTCTCCTGTCATGCA
CGAGCCACCAAAGTCCCACTTGTAGCTGAGAAACCTCTGAAAGAACCCATATCCTTTCTG
GTCACTCCAAAAACTCAGGATTCACAT
gtgaacatcttgctaatgaataagtccaagtctttaccttgttctatggataaatggaga
tgttttagacactgtagtaacgcttgtttaaacctattattttacctatccctttgttcc
tttcctattctctgtacttgtagtctgacgtgtgcccactcaatgtttggcctttaaaag

Exon 18 +      28918      29097   2   Internal    180    91   Excellent
aaaagtttctattgatggtgttaattttggatgagagttgtctgaatgattttgtggaca
ggtgtttcatcttgccttaaaatcagcataaacaggatctggagtactgatagagagctg
gcatggttttaagttgatgattgattgttctcaggctcattttctgaaatactgaggcag
TGCTGTAGTTTTGGATTCCTTGACTACTTCATACAAAACAGTCAATGTTGTTCAGTTTGA
ACCCAGTAAGGGAGCAATTGGTAAGGCATATAAGAAGGATGCAAAACTGGTGATGGAGTA
TCTTGCCATTTGTGATGAGTGCTACATTACAGAAATGGAGATGCTGCTGAATGAGAAAGG

gtaagatatcagatgtttactcttccatgggctccagtcagttgtgtcatctgccaggtt
ctgaaaggatgagattaatttcttaagattttttgcaggtaagtactgtatcttggctgc
atttaaaagactgtctttgccgagattttggcattatagcctgaaaaaagatttgaaata

Exon 19 +      30348      30435   2   Terminal     88    78        Good
acatagcaactatccaaaatgaagcatagaaaaaaatgagactgggaaaaagatgtccag
tgggacaatatcaggcagtctaatgcatgtgtaattgagagtcctagagagggtgtatag
aaaaaatattatacagtagctagaaaatttacaaatttgatgaaaacgctaaaactacag
ATTCAAGAAGCTTAGCCCCAAGCAGGATAAACACGAAGATGACCACATGAAGACCCGTGA
GAATCAAATAGCTAAAAACCAGGGATGA
agagaagaacctttaaagcagctagtggggaaaaagactcatcacataaaagcaaacaaa
gataagaatgattagaattcatatcaaaaactgcgcggatcacaatataatggaatgaaa
tcttttaaagtgctttaagacaaaattcctacacccagcaaaaatatctttcaaaaatga

Exon 20 +      32869      32954   2   Internal     86    83        Good
gactaatgcttaatttggtgtttcttatgaaataatttaaatttgacatcacttattata
tctggagagttgatcaagttataaaaagaaaaaacaacttagcaatctacaaaattcctt
taaattaaggcacagggtgcctgtttgaactaatacaaaatgtgttttgtttcttcgtag
GGAATTCACAATTGAAACTGAAGGGAAAACATTTCAGTTAACAAAAGACATGATCAATGT
GAAGAGATTCCAGAAAACACTATATG
gtaaatttgtaaaaataataaacaaaaagtcactgctccttaaagcttttgttgttgttt
gagacagggtcttgctctgtcacccaggctggagtgcagtggcacaacctctgcctcccc
ggctcaagcgttcctccctcctgtctcagcctccgaattagctgggactacaggtgcagg

Exon 21 +      35195      35304   1   Internal    110    93   Excellent
tcaccatgttggtcaggctggtctcgaactcctgacctcagatgatccacctacctcagc
ctcccaaaatgctgggattacaggtgtgagccaccgcagctggtgaattgtttagagaga
atctgaaatgcattatgtggtatttgagagaatgttattgaatttctatctctttttcag
TGGAAGAAGTTGTTCCGAATGTAATTGAACCTTCCTTCGGCCTGGGTAGGATCATGTATA
CGGTATTTGAACATACATTCCATGTACGAGAAGGAGATGAACAGAGAACA
gtaagttgttgtgtacagtgtgctgttatagtgtcagaaaataaaaattttctgaattac
attgtgaagtacattaataagactctagaatggtcaattagttattactataatctagtg
ctattaacactcatctttgcttaagtatgtatagacaaaccagtttcctgtgttatctta

Exon 22 +      37787      37899   2   Internal    113    85        Good
ggtcactgaggttcataggtttttctcttaaaagacagaatgggctttggtttgggtcac
tgccacttgtttgaatatttaggtagtctccacagaaagtcttttatgtggaaccaaaaa
attaccgtcttttatatacagtagctttcagaatgctttcacatcatttgacttttttag
TAACGGGCTTGTGAAGCAAGCAGAGCAGGTGGTAGAGACCTGCTTTTTAGGTGGAGAAAC
TAAGGTTCAGAAAGAGTTCATGACTTGGCCTAAATTCGGAGCTGAAACCAGGT
gtttctgatgctggttctgcttctcttttgccatactgcttttcatgtcatgttttctgg
cattttggtaatgacgttatgcttgaacacttgctgaatattaacctcttttggtttggg
atattagcatttagatatttacaaattaacatatttggatttttttctttttaaatcatc

Exon 23 +      38083      38235   0   Terminal    153    45    Marginal
tctgatgctggttctgcttctcttttgccatactgcttttcatgtcatgttttctggcat
tttggtaatgacgttatgcttgaacacttgctgaatattaacctcttttggtttgggata
ttagcatttagatatttacaaattaacatatttggatttttttctttttaaatcatccag
TTCTTCAGTTTCCCTGCTGTAGTTGCTCCATTCAAATGTTCCGTCCTCCCACTGAGCCAA
AACCAGGAGTTCATGCCATTTGTCAAGGAATTATGTAAGCAAATTCAATTGGGTAAACTC
CATGGGAACACCATCAAGGAGACTGAATTTTAG
gaaatgtatcatttatttcaataaaaatatagactgaataaagaatataaatgattttat
aaagagtacatgattttagcctgtactcttatttctaagcgagaggatatgcttgctcag
atgttttattctggcatttgagtgaggcaaggtaggacccaagagtcagatttaaaaatt

Exon 24 +      38882      39072   1   Internal    191    67    Marginal
ttggattcccgcaagggatttattaaactttagggatatttctttctcttgcaactcaac
ttgttgctttcttgtcttggtcccatttataagtctcctgagcttgtaagacagtagtta
gataacactgggcttaactccattgttttatttttaatttactttgtttattttggatag
CGGAAGCCCTGACCAGGCATGGAGTATCTCACAAAGTAGACGATTCCTCTGGGTCAATCG
GAAGGCGCTATGCCAGGACTGATGAGATTGGCGTGGCTTTTGGTGTCACCATTGACTTTG
ACACAGTGAACAAGACCCCCCACACTGCAACTCTGAGGGACCGTGACTCAATGCGGCAGA
TAAGAGCAGAG
gtatctggccttctctttggcatttttagccttagaaatgtgtactgcttcttactgatt
tgtgttggattttgatgtgtttatgctccctttcctttttttttctttttaattttaatg
aacggcttgtatcagacagagcccagattctcaagtcccccggtttaattatgaaaatat

Exon 25 +      39432      39563   2   Internal    132   100   Excellent
tccattagcacttctctaatattttataaacatttgtgttgctccaggcttattctccag
cagtttgcttttatacttgtttgtttattgggcaagagaaatatgatcctaagaatttgt
tgccatagttttattggtaggctttggagggttagacattttaatgttttatttttacag
ACGCGTATACATGTGTATGTATAAGCTTTTCCGTGTTCATATATTCAAAACAGTGAATCA
TGTTTCAGTAGTTTTGGTCAATAGGAAGGCAGTAATGGAGATGGTAGAAGCACAGAAGGA
GAAGGATGAGTG
gtaagggaaaggaaagagtagctgctttaattgacatctgcctgcctaatttatcacctt
tgagcacatacatcaagtgcctgttctgtgcttagcttgatacagaagtaatagggaaaa
cagaagcaaaagactgcttttttttctgaaggagtttatagtctaatccagaagtcgtga

Exon 26 +      40370      40495   0   Terminal    126    91   Excellent
ttgtggcagaattgagttgtctgggggaactggtgggcgttttgggctagaagagcatga
acccatgcctggcatgacattgtttggctctgtgtaaggtttcctgagttcaggatgaat
cttcttcttaaaaatctgaacaagttggttgatacttggcttctctttccttgtctctag
ATCTCTGAGCTGCCCAGCATAGTCCAAGACCTAGCCAATGGCAACATCACATGGGCTGAT
GTGGAGGCCAGGTATCCTCTGTTTGAAGGGCAAGAGACTGGTAAAAAAGAGACAATCGAG
GAATGA
ggacaattttgacaacttttgaccacttgcgctaataaaaaaaaaaaaaaactactctta
tgtccactttacaaaagaaaacagcattgtgattactcccagggaccgtattttatcttc
agtggctgcctgattttacccccacaattaaagttgaaggaatcctgaacaaacttgtga

--------------------------------------------------------------------------------