--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (32662 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1057       1148   2   Internal     92    64    Marginal
tgccccgcctcgcgctaccgcgcgtgccccatcatgctctgcgcgctcccattacgtgcc
gccacctcgcgcccctgcacgtacccaacgtgccctgcgtggtcccgttacgtgtcccat
catgtttcgtgcgcttccattacggatcatacctcgcacctcaccgcgtggcctctgtag
TTCCAGAGCTCGCGAGGGCCAGGGCCGTTGGCGGCGGTTGGAACGAAACGATGAGTGCCT
CCTCGTGGCCCCAGAATGGAATGCCGCCGTCG
gtaggggtctgccgggcataaaggggccttcggaaccccaccagagtcacagccagggag
ggcagcggggcgcaccaggccgaaggctcacgccacagggagggcagctaggacatgggg
ggaagcgcgttaaaccagggagtcctggaaggggacgacgcccccggccaggtgagggcc

Exon  2 +       1263       1319   0    Initial     57    64    Marginal
gttggcggcggttggaacgaaacgatgagtgcctcctcgtggccccagaatggaatgccg
ccgtcggtaggggtctgccgggcataaaggggccttcggaaccccaccagagtcacagcc
agggagggcagcggggcgcaccaggccgaaggctcacgccacagggagggcagctaggac
ATGGGGGGAAGCGCGTTAAACCAGGGAGTCCTGGAAGGGGACGACGCCCCCGGCCAG
gtgagggcccagacgtttcgggggcgtagacgctgaggggtggccgggtgggtctgcggc
tctgaggcctggctttcattctccatcagtccctgtacgagcggttaagtcagaggatgc
tggacatctcgggggaccggggcgtgctgaaggacgtcatccgagaaggagctggagacc

Exon  3 +       1409       1526   0   Internal    118    72        Good
cgaaggctcacgccacagggagggcagctaggacatggggggaagcgcgttaaaccaggg
agtcctggaaggggacgacgcccccggccaggtgagggcccagacgtttcgggggcgtag
acgctgaggggtggccgggtgggtctgcggctctgaggcctggctttcattctccatcag
TCCCTGTACGAGCGGTTAAGTCAGAGGATGCTGGACATCTCGGGGGACCGGGGCGTGCTG
AAGGACGTCATCCGAGAAGGAGCTGGAGACCTAGTGGCGCCTGATGCTTCGGTGCTAG
gtacgccctggggcggtttgtcctcaggatccatgtcatcgcactctgttgggaagagag
aggcctcattttcaaaaagcacttaatggggttggaaatgctttgtttgaagtggatttt
tgttttttgtttttgaaacggggtcttgctcagttgcccaggctggagtgcagtggtgcg

Exon  4 +       2194       2283   1   Internal     90    50    Marginal
cctctgagccaaagggccggcacccaaaatgcagagagaagatttattcctgtacctcgg
ggtgtcgggcagcttaagctcatctgttcacattgtttctgtgtgatcatgagagactcg
atattatggtggcgtgggtgtttttggtccattttccttacattctttcttctatcctag
TGAAATACTCGGGATACCTGGAACACATGGACAGACCCTTCGATTCTAATTACTTTAGGA
AAACTCCTCGGCTAATGAAACTTGGAGAGG
gtaggttcagagtgggagctggagaagaaggaattgtttaggggctagatgaggcacgat
gcctcaggctgggaagactgctcagagcgcaggttctttgagttggctttgctgaggctg
ggttttggtaacacagccatgttctctccccttgagacctaggcatttgggagatggctt

Exon  5 +       2984       3186   1   Internal    203    82        Good
aataaaatttctatcagtagaagctgggcacaggctcaggaggaagacattgcaggaaga
gggaactgtgtgagggagacatggaggccagagtactgctgacttagagggggaagaaac
tgatagcactgagcaggatactgagcaagcttcacccaccttctttgtccattcttacag
ATATTACACTGTGGGGCATGGAGCTGGGCCTTCTGAGCATGCGGAGAGGAGAGCTGGCCA
GGTTTCTGTTCAAACCGAACTACGCCTATGGAACGCTGGGCTGCCCTCCCTTGATCCCCC
CAAACACCACTGTCCTGTTTGAGATTGAGCTGCTTGACTTCCTGGACTGTGCTGAGTCAG
ACAAGTTTTGTGCTCTCTCAGCT
gtaagttccagagcacagatgtcagcactttatagagagacgaatgggttggtgttattg
gtaattcttctagatggcctgccctgaggctgatcgtcctctccagggtacccccgcggc
tcctgtgcggtggcggcggagttcctctgcttcctagtctgtgtttgtcttagtaatggc

Exon  6 +       4491       4610   0   Internal    120   100   Excellent
agagctcacagctgtagtaacacttcctttctttcaattactatttttttaaatggagac
atgttctcactatgttgcccaggctggtctcgaactcctgggctcacgtgtactaacact
tccattgtggcattactgcttttggtttccttgctgaatattcctgtctctggtcctcag
GAGCAGCAAGACCAATTTCCACTTCAGAAGGTCCTGAAAGTGGCAGCTACGGAACGGGAG
TTTGGCAACTACCTTTTCCGCCAGAATCGTTTCTATGATGCCAAAGTGAGATATAAAAGG

gtgagaatgctttgaaagttaagtgtaagtttagatcctgaaaacttccttgtttaaaaa
acacagattttgttttgttgtgatttttgttttgttttgtttttgagacaagagtgtcgc
tctgtcgcccaggctggagtgcagtggcgcaatctcagctcactgcaagctccgcctcct

Exon  7 +      13471      13657   0   Internal    187   100   Excellent
aacaagactccgtctgaaaaaagaagaaaaaagaaatatacctgacttcttatgttgatc
ttgtgtcttgcaacctgtaacagccgatttttagctctgatagtttttgcgtgtggattc
tttagggttttgtacataagactgttactcctcttgaccatctgccttccctctccacag
GCCCTGTTGCTTCTGCGCCGGCGATCAGCACCCCCTGAAGAGCAGCACCTGGTGGAGGCC
GCCAAGCTTCCTGTTCTCCTGAACCTGTCCTTTACATACCTGAAGCTAGACCGACCCACC
ATAGCCCTGTGCTATGGAGAGCAGGCTTTGATCATTGACCAAAAGAATGCCAAGGCCCTC
TTCAGGT
gtggacaggtgagttggaagccagtgacttgggaataaacacccaggaaaaggtagtagc
agtgctcaactcagctactgcaaaaatgctgtctttttttttttttttttttttagacag
agttttgctcttgttgcccaggatggagtgcagtggcgcaaattcggctcgctgcaacct

Exon  8 +      21761      21811   0    Initial     51    75        Good
catctggaatggtgctcagaactcagaaacacctacttatagtcactagtttattacaga
ggtttttaaaaggatacaaatgggccagacatggtggctgaggcctgtaatcccagcatt
tcgggaggccaaggtgggcagatcgcttgaggtcaggagttaaagaccagcctgggcaac
ATGGTGAAACTCCTTCTCTACCAAAAATGCCAAAATTACCTGGATGTGGTG
gtgtgtgcccgtggtcccagctacttgggaggctaaggcaggaggattgctggagcctga
aaagtcaaggctgcagtgaacccagatcacgccactgtactccagtctgggtgacagagt
gagaccctgtcccaaaaaaaaaaatttaaaaagggtggccaggtagggtggctcacgcct

Exon  9 +      26305      26423   1   Terminal    119    80        Good
tgtatggtaatgtattcgtgggttccgggaattggaacaaggatatcttggggggcattt
tcccatctctcatactctgttacagatcagcatctgtgagggactacacatcttgccaat
gcagagataactcagcactctgcatcctcagcattcttggcttaatcctttccgtcccag
ATGAGATCATCCTGACAGCCGTCTTTCAGAACATTTCCTTTCTCGTGCTCCCTTCTGGTG
GCTGGGGCCTGATGGACACAGCTCACCTCATCTTTCTGCTGTTTGTTTACTGCACTTGA
gggttgctgtactgtttacattgttaacaaatgctaggtttgctacaaccccacatcaag
caagtccgttggtgccatttttccaacagcatgtgctgaatttatttctctgatttacat
tttggtaattatcacagtatttctttttttcttcttttttttttttttgaggcaaagtct

Exon 10 +      27926      28200   0    Initial    275    44    Marginal
gccaccgtgggaacggcacctgctgagccttgatcctcagctctttgtcctccgatttcc
gacagaaacatcctgggctctacagcctccagcccgtggctccgcgattacatcactcct
ctgtcttctctgttacatttcacacccttctttgattactgcttattatgttgtgcgatt
ATGGTGGACACCACTGGCATTGCTGCTTGGGTTTCTAGTTCACAGTCCCTGTGCCTTTTC
CGAGGCCTGGGGCCCACCCGCCGTGGAAGCAGCCTGGTTCGTAGGAATGGATTCAGCTGG
AGTCGGCTGTGGACCTTTGTCTGTGTTCGCTGCCTCAGCCTGACTGCCATTGTCTTTGTC
GATCTCCGGACTTATTTCTCCTTGAGCCACGGATACAGCTTTTTTCTGACTTTGCACCTC
TGTGCGATACATGTATTGGGTTTTCAAAATGAAAT
gtgagctgagctttcctatgttggcgcattctcgtttatgctaaagtgttactttttatt
ggctccgatttgaaaattcaactacctgaacctcgtgggatcccttcgtctgtagggagc
ttgaagttgatctccccccatctgcattcatgcctggagaatattgattttagggcttat

Exon 11 +      29943      30052   1   Terminal    110    58    Marginal
ggtgcctgccaccacgcccagctaatttttgtatttttagtagaaacgaggtttcaccat
gttggccaggctgattttgaactcctgacctcaggtgatcccccccagcttggcctccca
aagtgctgggattacaggcatgagccactgtgcctggccctcctctcatgtcttattcag
AGCCTGATGGTGCGGTGCATGCTTCCAGAACAGTAGCGATGGGTGTGCCTCATGACCGTA
ATGGAGCTGCTGCTCGCTCCACCGTTAAACACCATGCTGACTTTGGCTGA
gctgtatttttttcttatcatgttatggaaatgtttgtttgtttttgtttggtttggttt
tttttttttttttttttttgagacggagtctcactctgtcactcaggcgatcttggctca
ctgcaacctctgcctcccgggtataagcaattctccttgccttagtctcccaagtagctg

--------------------------------------------------------------------------------