--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (49814 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       8520       8624   0   Terminal    105    68    Marginal
taaaagttggcctagatggggcactttcatgatttagctgagcacttttgctaacctgtt
tttaagtggagggagaagcaggtattatattttaccaatttcattcttagaagaatggag
ttttatctaaattgctgtagatagaagttttccgaagtgtttttctccattcactgtcag
GAGCGCCAAATGAAAAACAAGGTAGAGCAGTTTATGGTGGATTGTGGAGGAAAGCTGAAC
TTGCCTAGTATAATCCCAATTTGCTTCATATCTGGCATTGGTTAA
cattctaggggaaatttaaaaacactttctggctcatttgtgcttttccatagtatactt
ctaattctatttctgtttcttagccacatttagatgttctcttttaaatgtaatttcaat
atgatgctacttaagaaaataagaaaagccagatgatgttgattcagaaaactgtcaaaa

Exon  2 +      18438      18567   0    Initial    130    45    Marginal
aatctgagaattctttgatcaggaaaattctttatcttgatgaattgtttgtataatttt
tatgtatctcatgtaaaattaagatctaatagatacaaagtagaaatgtattgatcttaa
aaaatttataaacatttttcatagaaatgcaaaataaaagttctgtgggcttacaaagtt
ATGCTGAAATACTTCTGCCTTTTAGGTGCTGCAAAGTTGGTGGTAGCTGTGGCAGTGTTT
TTACTGACATTTTATGTTATTTCTCAAGTATTTGAAATAAAAATGGATGCAAGTTTAGGA
AATCTATTTG
gtaagttttatttttttcctttcttaaatcttatttttgatgtggcctaaagttttatca
gttatcagcactgagtcactcagtgctagaaaacgaaatgtgattattatatatccataa
atatgatttgttagaatattttacagtatataattagatattttggaattaatttagtat

Exon  3 +      26051      26158   2   Internal    108    79        Good
gaggttctttgaaaccctcaggggaaaaaattagcttgtattttaagatacgtgtatctt
gatgtttttcttaatgctctttgtggtttgagatttgaagtaaagtgaggtaaagtctgt
taacttgttttctaaaaaaagacatcatgttttctcccccaaagctacaaagcctcccag
ATATAAGTGTGGGATCTCAAAAGCTTGCCCTGAGAAGCATTTTGCTTTTAAAATGGCAAG
TGGAGCAGCCAACGTGGTGGGACCCAAAATCTGCCTGGAAGATAATGT
gtaagtctttgttgacttgagacgataaggtgtgctattaaattgcagccaattgaacct
gagtttaatggatattttgaaaatgtgttcggtatactttattaatggaaagtgatttcc
atttttgttatgtagtttttttctcatgaattcaagggaccttaaagttcttaaatttta

Exon  4 +      33269      33327   2   Internal     59    75        Good
aaattattcagtattagactgtcttctctgacttagtagagatctttttaatttcctccg
cagcactgaacaattgaaaatatgtataatattcctaactttttttgcaagactttattt
ttctgatatgttattgtacaatatttaattctaaatttatttcaatttctcccccttcag
TTTAATGAGTGGTGTTAAGAATAATGTTGGAAGAGGGATCAATGTTGCCTTGGCAAATG
gtaagaacaattattttagcttatggatgtaatcattgggtatttttctgtcccaaagta
aaatgcactatcagaggatcaggttagaaagtactgctcttgatgataaagccctctgtc
ccatccctgccctgcaaaaaatctatgggtggagacttggtgtctaagaatttatagcgt

Exon  5 +      37330      37414   1   Internal     85    89        Good
gttaagggacaaatttaacagtttttaaactctttatgagatttgtctgtcttttggatt
actttacattggaaattattgctttacagatacttcatgttttataatactactttcaga
gattatcgtgatgcttattcagtcattttttaaaaccctaaaccctttctttttcttcag
ATGTGGCACCATTTATTGAGTTTCTGAAGGCCATACAAGATGGAACAATAGTTTTAATGG
GAACATACGATGATGGAGCAACCAA
gtatgtaaacttaaaactttacagaactttttggaactataatttgtaattataaaagca
atacattttcattaaaaaaaaaatctgtaacatagagcaaagtaatcaaactaccaggta
aacacaactaacaatttttgtttttactttgcctccttcctggttttatatgtaaatgtt

Exon  6 +      37909      38015   1   Terminal    107    75        Good
tcagcagttatgggctcacctttaaagtttccctattattatgtcattagggtaaatttc
aagaaatggagttaattgtcaaagatacaggtgtgctatattttaaataattttaatata
tagtagttttataactttttcttaaaatagtatatgttgtaaaaatttggaaaattatag
AAAAGCGCAAAGAGACCAAGTTCCAGTCCATCTCACTACCCAGTGTAAACATTGATGATA
TTTTAGTTTCTATTCCAGATGACTTAAGACACATTTTTTGGCATTAA
atatttagaatgctagtatttatagcatatctcttcacttacgtggtgaatatttcccct
tattattaaatattctttataaaaaattgtttatgcctgcctagtctggtttttaaaatg
tcatgatttataacctgtttaatgggttgcctattgctggacccaggctagttccaattt

Exon  7 +      44531      44595   1   Terminal     65    53    Marginal
catcatttcagctgtttatgagccaccctaaaggcctgtgaggtatcaattcataatttt
tttgagatgtaaatgtgaatggaaccccaaagcctctctgcaggaggcagtccatttagc
tgaccactgagcctactgcctgtgctctagacatttcaatactgtttattcttgttacag
CAGCAAAACTCATCGCTAGTGCTGATGATGCAAGTGTAGACTTCCATAAGGTAGTTAGAA
AATAG
aacatttggataaactacgcaagtggaatttgacagccttttagatccatggcatcccaa
taacatttggaaacaagaaaacaaggttcaggtgataattttggggcatttccctctagc
accaaagttggttatcaagtgagcaaacaagtggaaagtgatggataattcatgtaagga

Exon  8 +      45499      45529   2   Terminal     31    76        Good
ttgccttgcctcaggttttagcagaacaaacctctctaagtgacctgttagagctgtctt
ttgcgcagtatataggactcaatgccaaatatgtgtacaagtagcccttaattttttctt
cttcttctttttttaagctctatagctaccatttatgttctgagtttcttttctccttag
AGATAAAGGAGAGAAAATCATTGACCATTAG
gatgatcacttacacaaaattttttagggacatctttcaattagtagtttccctggtggt
tgacttctgtcactgctccacctcctgctagtaggcatttagctgctgtgtggttaatat
tttcatttttattaagtaaccacttggcagttatcactgaagtacaatttatatatctgt

Exon  9 +      49460      49620   0    Initial    161    79        Good
tattggacttgtttttaagtgaatcagctatgttataattttatgacagatcaaagctga
gttcatttagcctgttgcactttatactttaaaaatttacataaattttaaataacttga
ccaaaaaagttataatttcattcagtttggtcaacaaactctcccttaattgaatgcaaa
ATGTGCCATGTTCAGTTAGTAGAGCAATTAAAAGTGGAAATTCATTTAGAATACTTTGTT
TCAAAGGAATATGAGAGAGATAAATTACTTGTGTTGATTAGGGAGATTTGTCACTTAAAC
CTCTTCAATTATTTCAACCTCTTGTACAGCAATAAATCCAT
gtaaatttagagctatagaataaaataacagattgcacctttgcattcctcaaaaggatt
ttctgtctcttttcagaatgatttttctaccacatacttgatttttgattatcacatgct
gtaactagttaatttctatttccatccaaactcgctcaatttaagccttttttctctgct

--------------------------------------------------------------------------------