--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (82701 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (20 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        766        901   1   Internal    136    68    Marginal
ggcgaagtctccacgcgctcccgttcgccggggaacttagggtatccgggcttccctaaa
ttgacaagcgggggccggcgccttcgccgccttcgctggccgccgcttggtttgttcttc
ttctccttcggggacttctccgcccgcgcccgcccgcccccagctttcgtcccgctgtag
GCACTGCCACCCAGCTCCACCGCAGACCCGCGGAGCACGGCGGCAGACGCGCTCCGGGGG
CCGCCGGTCAAGAGGAAGATGAAGGGCGCGACGACTTCGCGGTTTCCAGAATGGGCTCCT
TCTGGCCCAACAATAA
gtgccatttggaatcttctcggccttctctgtgccttccgcgcgtctgggctccccggta
ccgtagacccggccccgagctccgccccctcgccctgggcttccccgccccctcgccccc
agtctcctgggctcttcggggcggcggaagagccgagaaccttcgcgaaggtggggcggg

Exon  2 +        876       1330   0    Initial    455    58    Marginal
tttgttcttcttctccttcggggacttctccgcccgcgcccgcccgcccccagctttcgt
cccgctgtaggcactgccacccagctccaccgcagacccgcggagcacggcggcagacgc
gctccgggggccgccggtcaagaggaagatgaagggcgcgacgacttcgcggtttccaga
ATGGGCTCCTTCTGGCCCAACAATAAGTGCCATTTGGAATCTTCTCGGCCTTCTCTGTGC
CTTCCGCGCGTCTGGGCTCCCCGGTACCGTAGACCCGGCCCCGAGCTCCGCCCCCTCGCC
CTGGGCTTCCCCGCCCCCTCGCCCCCAGTCTCCTGGGCTCTTCGGGGCGGCGGAAGAGCC
GAGAACCTTCGCGAAGGTGGGGCGGGCGCCCCCGAGGTTGGGCCCGCGGTATGGGCAGTG
GAAACTGCGCATGCGCGGCGTCAGGGTCGGGCGGAAGTTGACGCCGCCGTGCCGCCGCCG
CGTGACGCATTTCCTGTTTGTTGTTGGAGAAAGGAGAGAAAGGAAAGCGCGAGGAGCCGC
CGCCACCACCAGCGCAAGCAGTCCTGGAGCTGTGAGGAGATTCGGGCCGTCACCCTGCCT
CCCCTGCGTCCCGCCACCGGCCGCTTCTGTCCTCG
gtgagggtctgttccgagggtcgggggaggtcgcctagggcccgcgcgcgcccggcagac
ggcggacctcacccggcgcctggcaacagcgcggggggtgaccggggtcgccggccgggg
aaaggactggacggggcgggggcgtggccggggttgcggggcgaagggtgggcggggtcc

Exon  3 +       2902       2965   2   Internal     64    53    Marginal
gtctcgaacttatgacctaaagtgatcgcctgcctcggcctcccaaagtgttgggattag
aggcgcgagccaccgcgcctcgccgactccagacttgtttccactcctgagggccttaag
ctcccttggagtttgtgctttcacatttctttctgccttccgtgataaagggatgaatag
TTTTTATGCACGCTTCAGCGAGCTGCGGGTTTTTGTGGATTACGCAGGCTGTGAAATTTG
GGAA
gtaagttgccttaagttggtagatgtggagatttgacaggaagtgggagaacaaaggggt
tgggaagcttttggaaagtgtccaggcttcatctgtgctgtggaaggtgagaaagttggg
aattccagagggcagagctcttaaagaatttgagatgagttcagcactctcttcaaaaca

Exon  4 +      16305      16331   0   Internal     27    77        Good
tcgagattgtgctgctgcattccagcctgggcgtcagagagcgagacactatctcaaaaa
caaacaaacaaacaaacaaaaaaacaaaacttctcaatttaaaatatttactccaatttg
tggctcacgcctgtattcccagcactttaggaggctgaggtgagcggataacgaggtcag
GAGATCGAGACCATCCTGGCCAACATG
gtgaaacccgtccctactaaaaatagaaaaattagctaggcgtggtggtgggcacctgta
atcccagctactccagaggctgagacaggaaagtcgcttgaaccagggagttggaggttg
cagtgagccaaaattgtgctactctactctggcgacagagcaagactctgtctcaaaata

Exon  5 +      20394      20461   1   Terminal     68    87        Good
gagctgtttggacttgcgagggcatgtgtgcttggtgtgtggcacattgaatggcctctt
gctatatatagtgctcagaggggatgatccagatgtctggcatggggagactggtactga
gatttctgctcttgttctgttagtgagagtggattagcagcttccctctgtttctgctag
GTACTGCCACTGGCATCACTGCCAAAATGCCACCTCAGATCGTTGGCAGCAAACTGGAGC
TGGAGTGA
aaataacctcacgtagtcactcagccaagggaatgagggagacgtgaagaaacgctggct
ttcctgctgcttgttgcctgctctgtcttgtgtgctgtgactgatgggcaggtttttagt
tactgaaagaagattgcggtgttcctacttacgggagtcgactcctgtcttttctctaga

Exon  6 +      21274      21300   0   Internal     27    61    Marginal
ctgtcgaattgataatgtagtttatatacatctaaatagatcctgatttccattatagtt
ttttgtttttttgatgaaaggacttccataaaaacaagagttttaggtccaggtttggtg
gctcatgcctgcagtcccagcactttgggaggctgaggtgggaagaatccttgagcccag
GAGTTTGAGACCAAGATCAGCAACAAA
gtgagaccctgtctcaattaaaaaaaaaaacaaaaaacaaaaaccaagagttgaagtttc
cacagatgtgtctttgtggctttgtgatactgttgtccttccttccttccttccttcctt
ccttccttccttccttccttccttccgtccttccttccgtccttccttccgtccttcctt

Exon  7 +      23199      23291   0    Initial     93    63    Marginal
cttggtttatatctgaagttgatgattgtttcactgaggatgtgagataatcccaaacat
cttttacattggactttgaaaatggagctgacttggcattcttgagtgcccctttggaag
gcaggggcccagagtacatagcactcaaattttcttgttgtgattgttgggctccggcct
ATGCCACTGGAGTCCCTTCTGATTCATATGAAAGTTCGAGAACTGCAGCGCTGCCTGTGG
TACCTGCATCTGTGTGACCAGGGCCTGGCCATT
gtgaggagggcagttcagccacagaaggctctcacggtaaccttagtctgtttaattaat
gaggtgttaactgtgaatgtagagtatacagcaaagacgtcatgaaacagattgttagat
tttaacatagctagagagcagttagcctggaatagttggaaccaacttaaaaaaattgtt

Exon  8 +      27436      27506   0    Initial     71    58    Marginal
gccattctcgtggttaatgatgttagtttcaaaagcatagttgatttctggatttagaat
gtgatctatatcctttattctttccaagatatcggaaactggcactgaagtggcatccag
ataaaaatcctgagaataaagaagaagcagagagaaaattcaagcaagtagcggaggcat
ATGAAGTGCTGTCGGATGGTGAGTGACAGCGAGCTGCTGAAGGACCCTGAGCGGGCATGC
CGGAATGCGGA
gtgggtgttgggatcctcctcagggtagcacagtatggactcaagtgacttgtttttgat
gcctactggattttgggcccttctaagagatttttacttttctcgtgaagatttgaattg
atttaggtaaccacgagtgctggggagctccagggcttctagtagtttctcctaggatgg

Exon  9 +      30686      30745   1   Internal     60   100   Excellent
gagagaggtacagaaagttttccctgttgctttgttttgttttaaagaaaaggtggccat
actccttgaaattcagttgtaaaacatcgaaaactgatttacaactggggaaatacctta
tctattgaattaagggtttaaaaggaacttggccttaccgacttttctttcaatttttag
CTAAGAAACGGGACATCTATGACAAATATGGCAAAGAAGGATTAAATGGTGGAGGAGGAG

gtaagtacgtgagttttttctttgaagacaaaaggtcttggcaagtaagttgagtttgta
aatcacgagtctcttggtcagagtcgattttgtatcagtaaatagagatgcaacgtagaa
agcgaactaaattggggagaggacagagaaattgatggcatttaaaagtcttttacgaga

Exon 10 +      31557      31693   1   Internal    137    52    Marginal
ctgggcacactcactctctgtcagtacagggctcatgttttgaattatagagaacttcag
gtttatgaaatatttttgtttttattagttcatgatttgtataatgttttgtcaacaaag
aattctttgcctacaaagcaccaaaattcataaactaaaagctgtgttgtatttgtgcag
GTGGAAGTCATTTTGACAGTCCATTTGAATTTGGCTTCACATTCCGTAACCCAGATGATG
TCTTCAGGGAATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTTTGGTAAGTTAA
TCACGTGGGTTGACTTG
gtgtgtgtccatgacccaaatgagggcttacttagtatggcctttctgttgaattaacat
tgtattttaggctgggcgcggtggctcatgcctgtaatcccagcactttgggagcctgag
gcgggcagatcacctgaggttgggagttcaagaccagcctgaccaacatggagaagccac

Exon 11 +      34948      35052   1   Internal    105    69    Marginal
taattagatgtgagtgaataagtgagtttttacccctagtccaaggagagaggtgctagt
cttactgaagcgctttactgttaaatgctccattttacatgcagacctattttaagacca
ggtaccctgtgtttcccatgattagtgtggcagtgatacttgttcattccgttcttatag
GTGTTCTAGATGACTTCCATTTTCAGGCTCTCAGGATTTACACACTGGGGAAGCTGCTGC
TCCATGGCTGCTATATGTATGTAGTCACTGAGCAGCCTGCTGACG
gtatgtttaatgtagatgggtgtggatgcagagccagagggatttccgcttattcatgat
gtagttcaggggtcaacaccctggtctgtggcctgttacgaactggcctgttgggaacag
gaggtgagcggcgcgcaggcaggcaagcattactgcctgagccccacctcctatcagctc

Exon 12 +      36331      36673   1   Internal    343    96   Excellent
ctttgtaaagcatcactgtggtacgaatgatgctctgtagcaatagaggaggagtcctgt
ggtatgtagaaccaaggaaagcagacttcttgcaggaaaaatgagtgcattgaggatagt
aacctgactttctgacctgtgattaaattatgatagtagtcagtcattttactctcccag
GGTTTGAGGAAGTGGCCGGTGAGGACTTGGAGCCTAGTGAGGAGTTAGTAGAGCTGCCCA
GGGTGGAGGAGGCCACAGAGGACAGCCCTGGTGAAGAGAACAGTGAGGCCTTGGATGTGT
TGATATCCAGCAAGGACCTGGCACTGTCTAGTGAGGACGAGGCCTGCACAGGATGTAACT
GGGGCCTGGGCGAGCCCTTCAGCGAGGAGCTGGGGCTCATATCCAGCGAGGACGGGGCCA
GCCCTGGGGACGTAGAGGAGCTCAGCGAGGAGTGCGAGGAGCCGCTGAGTGAGGAGGAGC
ACAGCGGGCCAGAGCTGGGGCGCTGCCGGCACCACCATAAAGT
gtcaaggagctgcccgagtgggactgacttaaaacagtgtatctagaataaaatggtttc
ctctagtgccttgatactgtccttggtcagacgacctcagctgccttggagatagaactg
aagaagcaagagagggaggtggcagccctgaagcacaggccgggcgtctcgtaggctctt

Exon 13 +      37067      37183   0   Terminal    117    66    Marginal
gccttgagtttgatccgtaccacaaaccgggggcttaaactaccaaaatgtaccatctcc
cagtcctggaggctggccatgtgagacccaggtattgcagggctggttgcttctgaggct
gagatgtgtcccgtcttgctccaggcccttccccagctgttcttctccctacatttgcag
ACGGATGGCCCATCCGATGTTGACATCATCTCCTTTGTGTCTGTCTCTGTGTCCATTGGA
TTTAATGTTTTAGAGACAGATTTCACTGTGTTGCTTAGGCTGGCCTCCAACCGCTAG
gctcaagcagtcttccttcctcagcctcccaagtaactgatcacaggcatgagccactgt
gcccagccacaagttccccctttttataaggacatcatttatattggcttagtgcccact
gtaatgatttcatcttaacttgataatctataaagagcctgttcccagtaaggtcacatt

Exon 14 +      49717      49822   2   Terminal    106   100   Excellent
ttaattctattttaggaaaggaagatgtgttgttgacaggttggcttcagccatgttttt
acagcctgaaaattacttatattcatggtgtatttcagtaatgtccttaaacaacttagt
taccctcacacatgcattttctttaccagaaaggtttttaaatgaatttttttcctacag
AATTGTCGAGAACGGTCAAGAAAGAGTAGAAGTTGAAGAAGATGGCCAGTTAAAGTCCTT
AACAATAAATGGTAAGGAGCAGCTGCTGCGCTTGGATAACAAGTAA
ttcaacgcacgcacttaacagaaatgttaaactataacaagcaccatttgaggattaaca
ggaacatttttttgaagatttcaaacgaactcgactttcagtataattgtacctaaagta
tttataaacagctcatcggagcctctatttgtcatagacttttgagttgattgttgggac

Exon 15 +      52504      52533   0    Initial     30    43    Marginal
gaaaattacttttattctgttcttccattgatagaagtgtaattttattaagttactaat
agaatagaaagcctatttgttgctgtcaaatcttacacctttcatttttaaaccccgtta
agtttattcctagagaattcagtctaagggtgcatgagagtacctttgaaaagttaggaa
ATGGCTGTGAGCATTGATACCATCACTCAA
gtaagtgatggcttggaagaataatagcatttgatttaaattacagtttttggtaaattc
aacagtctctttacttgctgtagtgttgagcgcctctgaaaataggaagctgaacgctcc
ttaacggcacgtatctggttgtgcacagccccatgtggtcccatccattctggggtgtgc

Exon 16 +      61484      61591   0   Internal    108    51    Marginal
ctgcgaggcccgtgtgaagccagccccgtgcgtctgtagctaccccttgaggagtaaccc
gagcggcgtgcttcctgggaagttgctaagctgcgctgaggtggtaacaacagcatgtgg
cctccacctcacgtaagcatttggtgtctccttgaacctctgttgtgcaccagcacctag
GAGACACTGAAGAGCCAGACCCAGTCACGGCCGCCCAGCCAGGGAGAGGGGGTGCGGGTG
AATGGTGTCCTGCAGGTGCTGGGCCGGAACCTCTGTGTCGCTGCGGTG
gtgtgttcagctctgacatgagtggggatgccaaccccagcagggcttctgggaatcttt
tggccttttgttggcggggtttcgtgagcctcttatgctgggaggaatccaacaggagac
tttcctcctcattgtcctcagccttcgcccgtgctccgatttcctcctgtgtccccatgt

Exon 17 +      64493      64662   0   Internal    170    66    Marginal
tgccttttttcggtttctttgtgagctgcagtaacgggaaagcaagttctagggaagtgt
gagcatgaggtgctgggatgcctgggtccccgcgcctttgtgtatgtgctcgtgtctagg
gagttctgaacatgggggatgcccgggtccccgcgccttcgtgtacgcacttgtacgtag
GGAGGTCTGAGCATGGGGGATGCCTGGGTCCCCGCGCCTTCATGGACACGCTCGTGTGTG
GTGTGCCGTGATGCTTGCTGTGCAGCAGGCCGGCTGGTGGAGAGCTTTCGCTGGCACCGA
GCTCTTCTCCTTGGTGTGGCCGTCGGCTCCATCCTGGTCATCCTTCCCTG
gtaggtgttactctaaagctgggtcctaaacctggcaggagcttctaatgagaaggggca
cttgatcctcgggtgggctgtgtttacgttcttggctctggaattacctttgtcttgcgg
tctccgccgctggtggtctatgtctcatcaccaggctcaccgccggggctcttgcgtccg

Exon 18 +      72718      72762   0   Terminal     45    70        Good
tcctcttgggtttgctgaattccagaaacgatggagccctgtgggcgccgtgctgtggct
ttaggattttgtgaggcttgccctcccctctggggacacacaggctccaggctgcgagtt
gcccaggtcttggtgttcattggagatgaatttctgcacttgtgtgggggtcttccttag
GCCAGCATCACCATCGTGGTCTCCAAAGACCAGAGCCTGGCCTGA
ggggacagcctgagagcaggttccttcctgacctcggagcccgttctctctgttgtggtt
gagccacatttgagctcctgggggcaggccctgggcctggcactcagcactggaagtggt
gtataggccagtttaattggagaagctcctgaatgtctgtcggtctgtcagtccgttggg

Exon 19 +      73970      74212   1   Internal    243    75        Good
gaggattaagttctggccccagtggcgccactgaagaaaggagataacctctttctcctg
cccggagatggcgcgtctggattcagggagatcgtgcggccagcttccctccctctgctc
tggatgggggccggccgccgccgctcactcacggctctctctctcccgctgtgcctgcag
GTGTGGCCGACGACGATGCCCTCGCTGAGGAGCGCATGCGGAGAGGCCAGAACGCCCTGC
CAGCCCAGCCTGCCGGCCTCCGCCCGCCGAAGCCGCCCCGGCCTGCCTCGCTGCTGAGAC
ACGCGCCTCACTGTCTCTCTGAGGAGGAGGGCGAGCAGGACCGACCTCGGGCACCCGGGC
CCTGGGACCCCCTCGCGTCCGCAGCAGGTGTGCAAAGGGAGGCAGCCGTGGAGCAGGCGC
AGA
gtgagacttctctgggtgccagaggacagcgaggacacaaaccgcgcctgggctgctgtg
ttctgacctgagcgggcgtgggcggtcgggcggggcgggaggaggtagcctcgctctgct
cctctcccgctcgcggcgccccacgccacggtggctccgggccccccaccgttaaaacgg

Exon 20 +      80080      80162   1   Terminal     83    78        Good
gcagttctcaacgtgcaccttggaaagcgcccgttttgaggtttagctgtggccaagata
gatgacttcattttgttgctttttgttcttaacatggggagatatttagaaaacatgttt
ggctcttgctggggaagcagtgctgttccgtacagtgttttacaagccgtgtttccttag
GATTGAAAGAAGGTGGCAAGAGGAAGAAGCAGAAGCAGAGAGAGGAGTCGAAGAAGAAGA
AGTCGACCAAAGGCAATCACTAG
accggacttgaggcacgcggtgcacccccagacgctggcgctccaccgtgctcggcatgc
ggtcgtgcacacgcgctaggtagcagcgtcggtcaggactgtctcgaggccacactcgct
cggcaggattatgcgatcacggatcagtcagagcagggtcaggagacggggctgacggca

--------------------------------------------------------------------------------