--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (33405 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6777       6858   2   Internal     82    76        Good
gcactttttcatagttgccatgtagcctcatttttaatggccatacattaaaaccaaaga
ctagaccatttcctttcttttggcctggttacgtctgggataggaggcttgggggtttct
ttgccagctgaaagctcatcattatcttttgctcttttttccttttcgcttcttccccag
GGACCAAGTTTTGAGGATTAATGTCAGAAATGGAGACGAGATCAGCAAATTGAGTCAACT
AGTGAATTCAAACAACTTGAAG
gtacctggttctttttagctctcctgagtgttttctaactttgctgggagaagactcttg
ctctactggcattattatttttatttctgaggagtctctgaatataatcctgtgggagtc
cacttgccatttatacaattgagggggctgatgggagagagggagcacatcacagctgtg

Exon  2 +       7301       7435   0   Internal    135    92   Excellent
gatactgcttgttgggcaggtccaaccagacacaattgtgaaatgggcaaactttgccct
tgggcagagcctagcctctcagggatcaccctggcttttggcagtgttctagaagaataa
cctcattgtgcattttacctgaacggtcctttaacctggtttcatttctgttcccttcag
CTCAATTTCTGGAAATCTCCCTCCTCCTTCAATCGGCCTGTGGATGTCCTGGTCCCATCT
GTCAGTCTGCAGGCATTTAAATCCTTCCTGAGATCCCAGGGCTTAGAGTACGCAGTGACA
ATTGAGGACCTGCAG
gtaggtagactatgcctcctgcctcctgctcttgcataggaccaggcagccagtccagag
tagaccggagtgatttgcaagttctggttttatccttttctattttatagaccaggaaat
ggaggcaaatggaagtaaagtgcagtgacttgttagaggaacaacattttgtagtagaaa

Exon  3 +       8847       8996   0   Internal    150    88        Good
gaaataaaattttataaagatatgaaagaaatctaacccccttttaaaccttgacatttg
tgctgcttgatatgctgaaagggccgccatcttggctgacccatatgcaaagatatggca
gaaaaaacataaacctgcgtctgcaatggatcacttcacaacattgctgtgtgttttcag
GCCCTTTTAGACAATGAAGATGATGAAATGCAACACAATGAAGGGCAAGAACGGAGCAGT
AATAACTTCAACTACGGGGCTTACCATTCCCTGGAAGCTGTAAGTGTTTCAGAGTGGGTT
AAGATCAAGGTTCTCTGCCTCCTGAATTTT
gtaacctctctccttacttccaggagacattagtcttcagcacaatatcccctcactgag
gggctaaaatgtgtacacttcaattcctttctaattcttggattgctgaactcctaccag
cacctcagagtgtcatgaaatacagcctggctatttcctccctcaaccatccttctctcc

Exon  4 +      12509      12610   0   Internal    102   100   Excellent
ttgtagaaaaggactattcaggcaggtctcataatcagcgtttccatgccgataatatgg
tcaattccaagattagggtcccggaagagatagttaagatcaacaaggtaaatcacagat
atccagccatagataagcagatttttaaaatgtccctggattcactctttcatgcttcag
ATTTACCACGAGATGGACAACATTGCCGCAGACTTTCCTGACCTGGCGAGGAGGGTGAAG
ATTGGACATTCGTTTGAAAACCGGCCGATGTATGTACTGAAG
gtgaggccacatgcacttggaagggtctcctgggtcctcatgcccaggacccagcctcag
acctctgaaaagggtagctttttgaactccttgacttcagggaggaaagcgaggtcagga
cacattgtacctgggctggaacttggtctgacagagccccttgcttttgtctaatgtagg

Exon  5 +      13074      13151   0   Terminal     78    62    Marginal
ctttcattctcacctctgtaaatagcaggacaggttggggtgggcctgacttctattctg
ctttcagggggtacttactggaaaatcaacttaggaagtgaatttgagggttggtgtaat
tttaagcccagcctctgatccttggttgcacaaagcctaatttccaaatatttctaacag
ATTCAAGACTGTATTGGCAAAGAGGTAGAGAGCTATGATAATGACATAAATTACATAAAA
ATCCAGTTGAATGAATAA
gaaggaatttgggcgtataacccatggaacaccaatggtgctaagaatttgccaaaccct
cagcttcgtataagtcccaaagaactcaggcttatagcactaagcaaattaccagtggga
gaggagacctgccacggagctggataattacatttaaatatttttgccaatctgttggag

Exon  6 +      14818      14928   0   Internal    111    85        Good
gctcagagggctttgcagagagcagagcctctgagggtggcagggaggcttttgagggtg
gatgctgttctaggagcattcattctagctggttgctgggcatcttgagaagatacatgg
ttcagccctaatggcccatcctgccatgggatagctgacaagcatattgtctctgcttag
ATTGTATCTGATTACCAGAGGGATCCAGCTATCACCTCCATCTTGGAGAAAATGGATATT
TTCTTGTTGCCTGTGGCCAATCCTGATGGATATGTGTATACTCAAACTCAA
gtgagtattcccaaatgggctgggcttgcagactgttgaattccttgctttgccactaat
tgtctgatcttggagagaatttccacaaatgtgcaccttatgagcttccttgggatttca
tcttctagtcatcctcagagctgagaatcaccaggggatatttcttcttagagaaaatag

Exon  7 +      18818      19017   1   Internal    200   100   Excellent
caaccctccctcttccatgccttctctgcagtccacacccaccatggactaggtgctctg
ggccgtctcgccatggcctgcccattcccaataccttcggcccctctctaggtggagcgt
cttgcatttctgtgttcttggactatgagttaatgtttgttcttgggctatccccaacag
GAAAGGGAGCCAGCGACAACCCTTGCTCCGAAGTGTACCATGGACCCCACGCCAATTCGG
AAGTGGAGGTGAAATCAGTGGTAGATTTCATCCAAAAACATGGGAATTTCAAGGGCTTCA
TCGACCTGCACAGCTACTCGCAGCTGCTGATGTATCCATATGGGTACTCAGTCAAAAAGG
CCCCAGATGCCGAGGAACTC
gtgagtcacagctgcctcccacccagcctggggcccgcctgaccctcctggcgctgctaa
ggtggtagctctgcagctttatagggagggtccaggagcctaggcatgtttcattgaagg
tccaatcttctctccctgccctttgggatatgctgtcatctgctggggacaggaaaacag

Exon  8 +      20069      20228   0   Internal    160    90   Excellent
aaccatgccacctccctcagtttacagttgggccttggcactgggcgaaggggaaacaag
ggaccagaaaggaaatcggggggggctgagaatcttccaaaccatcccagagcagagcag
ctgaggaaggtcaagcttcaggatcgattttttctcactccacggattcccccttcccag
GACAAGGTGGCGAGGCTTGCGGCCAAAGCTCTGGCTTCTGTGTCGGGCACTGAGTACCAA
GTGGGTCCCACCTGCACCACTGTCTGTAAGTACTCGCTTATTTATGAGTTATTTAGAAAG
CACTTTGAGAGGAAACTTGAAATGGAGTGGGAGGAGGGCT
gtaagttagacttacttgtcatctgattgtttttgttgttggtaatagactgaactacat
catgcctgtgtggtgacagctgttgcatgcagtccccttcatcaacatcatatcaaaaat
tcctcatgcccatcccttcattttcaagggaaacccacctttcagttggtaaactgatgg

Exon  9 +      29640      29741   0     Single    102    41    Marginal
tctgtagggcaggaattcaatggtttagctagatggctctggctcaggatccttcatgag
gctgcagtcaagatgtcttccagggcctcagtcaacctaaggcttgtgtatttgtccatt
ttcacactgctgataaagacatacctgggactgggtaatttataaagaaaaagaggttta
ATGGACTCGCAGTTCCACGTGGCTGGTGAGGCCTCACAATCATGGCAGAAGGCAAAAGGC
ATGTCTTACATGGTAGCAGGGCAAAGAGCAAATGAGAACTAA
gcaaaaggggtttccccttataaaaccatcagatctcatgagacttattcactaccacga
gaacagtatgggggaaaccactcccatgattcaattatctcccactgggtccctcccaca
acacatgagaattatgggagctacaattcaagatgagatttgggtggggacacagccaaa

Exon 10 +      30520      30707   1   Terminal    188    98   Excellent
gccaatgcaggatgtcctgagacatagggatcaggctgatgattttgtcataggactgat
gacttgaggagcaaactctggattccttaaggaaccccaggcaggcagagctcttggccc
cttcccatctaacccaggagggaactgggcttcaagagtgttttgtcctccgacttacag
ATCCAGCTAGCGGGAGCAGCATCGACTGGGCGTATGACAACGGCATCAAATTTGCATTCA
CATTTGAGTTGAGAGATACCGGGACCTATGGCTTCCTCCTGCCAGCTAACCAGATCATCC
CCACTGCAGAGGAGACGTGGCTGGGGCTGAAGACCATCATGGAGCATGTGCGGGACAACC
TCTACTAG
gcgatggctctgctctgtctacatttatttgtacccacacgtgcacgcactgaggccatt
gttaaaggagctctttcctacctgtgtgagtcagagccctctgggtttgtggagcacaca
ggcctgcccctctccagccagctccctggagtcgtgtgtcctggcggtgtccctgcaaga

--------------------------------------------------------------------------------