--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (191099 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (42 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1386       1445   1   Internal     60    54    Marginal
gaagcaaatgacatcacagcaggtcagagaaaaagggttgagcggcaggcacccagagta
gtaggtctttggcattaggagcttgagcccagacggccctagcagggaccccagcgcccg
agagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaactttttttcag
GTGAGAAGGTGGCCAACCGAGCTTCGGAAAGACACGTGCCCACGAAAGAGGAGGGCGTGT

gtatgggttgggtttggggtaaaggaataagcagtttttaaaaagatgcgctatcattca
ttgttttgaaagaaaatgtgggtattgtagaataaaacagaaagcattaagaagagatgg
aagaatgaactgaagctgattgaatagagagccacatctacttgcaactgaaaagttaga

Exon  2 +      10663      10808   0    Initial    146    44    Marginal
agtgactcagaagaatatttttgctctgaatatgaagaacgcttagactaaaactttaat
tacgatgctgaagaagaaagtggtaggtgattgcatgaataagtatgtaatattgttaat
ttctaaaaactgtgtatagttaatgtagtgcttctttttggaaaggctattgttaaattg
ATGGTAAATTCTATAACCAATATCACCTTAAAGCAAGTACGCATGATAAAGTATTATAAA
ACCATGATAATATCATATGTGGCTTATTATTGTTCCCTGAGTGTTGTACAACTCTGTTAT
GCTGTGATGAAACCTCATGCAAACAG
gtatgtcaaagatatgatgggctgttaactgagcttggcccacatatggtgtagtgacat
gctcactaatgcagtgcagagataaccaataacagatcataacaggtttaaatatgtgca
aggagatgtcagcagaagctttcctacatagtgaatactaaacaagcctgacagcccagg

Exon  3 +      13746      13817   0   Terminal     72    86        Good
ttactatagaattgaaaaatgttttgaccttttttttttggcttttaatatatttgacca
agagtaacagctaagcaatacctatttgcaatcagtgtcatcatgtgggctccaaacata
tcatgtttgtgtaattaattgattgacccattaatttgttcaatttctgctctgttccag
GCACTGAACAACATGATGGAGATAAAAGATAAATATTACACCTGCCTTGTCCTCAAGAAG
TTAGTCTTCTGA
gggaaagaaattagcaaacaaattgtaatctcagttatgtgccatgttccatgctgggca
caggggatacagtagtttaaaaaaaacacaagatctataaggtgtttcttcttgtggacc
ttacagtctagggtgcttggaaacatggggcgttggcagacaagtaaatacacattttgt

Exon  4 +      20080      20175   0   Terminal     96    90   Excellent
cactagatgagttttagtctcaaatcaatcctccctatcatagtcacttatcaaaataac
taaagcaaagtggtagagctgtgctctagaagtttgggatttatgatcacaatcttttcc
aatgagtcccctctttcctctgcctgtcttcaacatttgtttttttttttttttggttag
GACTATCCAGATTGTGTGGCCTATTTCAAACTCATGGCAAATACATTGGATGATCAGAAA
TTTTCTAATGTATTTGAATTTGTCTACACAAACTAG
agtaattgctattaattcctcaagtgttaattatttcatgcaaaaaggaaaaaggctatt
agtctttaagtgtattagtatgtcaatatttgggagaagtgtcatgcaattagtggtttg
aatttcctattttattttattgcattttattttatttgcctagtcaaataaaaagtaatg

Exon  5 +      43193      43251   0    Initial     59    74        Good
taaagtaaagttttctgggtttaattcatttagtgtaattacaagcatgagttcaggttt
ctatttttttcacctgaactttccttcatggtttgaatatctagaaaaagcagactttcc
tatctctagactaaacatttgatcctatcttaggtatgcattacaattttttaaccataa
ATGGTTAAAGAATTTAGACTCATCTACAATAACTTTGAAGCTCTGGTCTTGAAGAACAT
gtgagaaatgagatataactcctagaagatataggagacatttttagtcttccaaatttt
ccctgggaggctgatctaaattgagtcacaaaattgttcccaccaggaatgcaatcactt
gagctgttttctaatctgagcccctctacccagatgatcttctgaactcatactgttcag

Exon  6 +      47280      49185   2   Internal   1906    51    Marginal
aattggagcatttagtccatttatatttaaagttaatattgttatgtgtgaatttgatcc
tgtcattatgatgttagctggtgattttgctcattagttgatgcagtttcttcctagtct
cgatggtctttacattttggcatgattttgcagcggctggtactggttgttcctttccag
GTTTAGCGCTTCCTTCAGGAGCTCTTTTAGGGCAGGCCTGGTGGTGACAAAATCTCTCAG
CATTTGCTTGTCTATAAAGTATTTTATTTCTCCTTCACTTATGAAGCTTAGTTTGGCTGG
ATATCTCTCAGACCACAGTGCAATCAAACTAGAACTCAGGATTAAGAATCTCACTCAAAG
CCGCTCAACTACATGGAAACTGAACAACCTGCTCCTGAATGACTACTGGGTACATAACGA
AATGAAGACAGAAATAAAGATGTTCTTTGAAACCAACGAGAACAAAGACACCACATACCA
GAATCTCTGGGATGCATTCAAAGCAGTGTGTAGAGGGAAATTTATAGCACTAAATGCCTA
CAAGAGAAAGCAGGAAAGATCCAAAATTGACACCCTAACATCACAATTAAAAGAACTAGA
AAAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATAACTAAAATCAGAGC
AGAACTGAAGGAAATAGAGACACAAAAAACCCTTCAAAAAATCAATGAATCCAGGAGCTG
GTTTTTTGAAAGGATCAACAAAATTGATAGACCGCTAGCAAGACTAATAAAGAAAAAAAG
AGAGAAGAATCAAATAGACACAATAAAAAATGATAAAGGGGATATCACCACCAATCCCAC
AGAAATACAAACTACCATCAGAGAATACTACAAACACTTCTACGCAAATAAACTAGAAAA
TCTAGAAGAAATGGATACATTCCTCGACACATACACTCTCCCAAGACTAAACCAGGAAGA
AGTTGAATCTCTGAATAGACCAATAACAGGCTCTGAAATTGTGGCAATAATCAATAGTTT
ACCAACCAAAAAGAGTCCAGGACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAA
GGAGGAACTGGTACCATTCCTTCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCT
CCCTAACTCATTTTATGAGGCCAGCATCATTCTGATACCAAAGCCGGGCAGAGACACAAC
CAAAAAAGAGAATTTTAGACCAATATCCTTGATGAACATTGATGCAAAAATCCTCAATAA
AATACTGGCAAACCGAATCCAGCAGCACATCAAAAAGCTTATCCACCATGATCAAGTGGG
CTTCATCCCTGGGATGCAAGGCTGGTTCAATATACGCAAATCAATAAATGTAATCCAGCA
TATAAACAGAGCCAAAGACAAAAACCACATGATTATCTCAATAGATGCAGAAAAAGCCTT
TGACAAAATTCAACAACCCTTCATGCTAAAAACTCTCAATAAATTAGGTATTGATGGGAC
GTATTTCAAAATAATAAGAGCTATCTATGACAAACCCACAGCCAATATCATACTGAATGG
GCAAAAACTGGAAGCATTCCCTTTGAAAACTGGCACAAGACAGGGATGCCCTCTCTCACC
GCTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATCAGGCAGGAGAAGGAAAT
AAAGGGTATTCAATTAGGAAAAGAGGAAGTCAAATTGTCCCTGTTTGCAGACGACATGAT
TGTTTATCTAGAAAACCCCATCGTCTCAGCCCAAAATCTCCTTAAGCTGATAAGCAACTT
CAGCAAAGTCTCAGGATACAAAATCAATGTACAAAAATCACAAGCATTCTTATACACCAA
CAACAGACAAACAGAGAGCCAAATCATGAGTGAACTCCCATTCACAATTGCTTCAAAGAG
AATAAAATACCTAGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTA
CAAACCACTGCTCAAGGAAATAAAAGAGGACACAAACAAATGGAAGAACATTCCATGCTC
ATGGGTAGGAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAG
gtaatttacagattcaatgccatccccatcaagctaccaatgactttcttcatagaattg
gaaaaaactactttaaagttcatatggaaccaaaaaagagcccgcatcgccaagtcaatc
gtaagccaaaagaacaaagctggaggcatcacgctacctgacttcaaactatactacaag

Exon  7 +      52141      52263   0   Internal    123    68    Marginal
agtcttatttcaaagtaccaagatattgaaaatagtgctaagagtttcacatatggtatg
accctctatataaactcattttaagtctcctctaaagatgaaaagtcttgtgttgaaatt
ctcagggtattttatgagaaataaatgaaatttaatttctctgtttttccccttttgtag
GAAGTCACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCG
GATAACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTT
ATT
gtgaggacactgctcctacacccagccatttttggccttcatcacattggaatgcagatg
agaatagctatgtttagtttgatttataagaaggtaatacttccttgcacaggccccatg
gcacatatattctgtatcgtacatgttttaatgtcataaattaggtagtgagctggtaca

Exon  8 +      54032      54109   0   Terminal     78    85        Good
agatcaaataaggggcaggttagtttgtaaacatgtccatatgtaacatttagcacaaat
acaggatataggtgctttcagacccagctgcattgataaaaagttaggtggtattgtatc
tgtcttcctttctcaatgttgcatatctgtgttcttgcccagtttgcttcatctctctag
CCACACTTATTGGCCTACAATGGCATCATCACCAAAGAAGGCAATCCCATCTCCGTGTGG
CTTTGGTTTGCTCCCTAA
agtaaaccttgtgtttacttttcccaggtctcatgctttcccatatctgacctgttttgt
cctcatggccaggatatgtgggacctttcctacaatgttccaaagtttgtaatagagctc
ttctctgctttgttccaaattctgcaacattttactttaaataatgaatttaaatacaaa

Exon  9 +      55518      55607   0   Internal     90    84        Good
ctgttgaaagaaacatttatgaacctgagaagatagtaagctagatgaatagaatataat
tttcattacctttacttaataatgaatgcataataactgaattagtcatattataatttt
acttataatatatttgtattttgtttgttgaaattatctaactttccatttttcttttag
ACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTGTTAGTCTC
CTTTCCAACAACCTGAACAAATTTGATGAA
gtatgtacctattgatttaatcttttaggcactattgttataaattatacaactggaaag
gcggagttttcctgggtcagataatagtaattagtggttaagtcttgctcagctctagct
tccctattctggaaactaagaaaggtcaattgtatagcagagcaccattctggggtctgg

Exon 10 +      57790      57915   2   Internal    126    94   Excellent
cacataggaggcatttaccaaacagtagttattatttttgttaccatctatttgataata
aaataatgcccatctgttgaataaaagaaatatgacttaaaaccttgagcagttcttaat
agataatttgacttgtttttactattagattgattgattgattgattgattgatttacag
AGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAA
TATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTT
AAGACA
gtaagttgttccaataatttcaatattgttagtaattctgtccttaattttttaaaaata
tgtttatcatggtagacttccacctcatatttgatgtttgtgacaatcaaatgattgcat
ttaagttctgtcaatattcatgcattagttgcacaaattcactttcatgggctgtagttt

Exon 11 +      61342      61543   2   Internal    202    90   Excellent
actgaggcccagagagattaaataacatgcccaaggtcacacaggtcatatgatgtggag
ccaggttaaaaatataggcagaaagactctagagaccatgctcagatcttccattccaag
atccctgatatttgaaaaataaaataacatcctgaattttattgttattgttttttatag
AACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTT
CTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGG
AATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGT
CACTCGGCAATTTCCCTGGGCT
gtacaaacatggtatgactctcttggagcaataaacaaaatacaggtaatgtaccataat
gctgcattatatactatgatttaaataatcagtcaatagatcagttctaatgaactttgc
aaaaatgtgcgaaaagatagaaaaagaaatttccttcactaggaagttataaaagttgcc

Exon 12 +      62837      62921   2   Terminal     85    55    Marginal
caggctttttcattatttcttatggccaagacttcagtatgcgtggacttaattcttcct
tatgctcctaccttccctagggaaactgatttggagtctctaatagagcccttcttttag
aatcacagtttgatgccttaaaactagttatataccttcacatgcttccttaacccacag
AAGTGATGCTAATGAGGCCCTTAATAAGGAGCGTGCTATTAAGATGAAGACATTCATTTT
TTTTCTCCGTCCAATGTTGGATTAA
ggcacattagtgggtaattcagggttgctttgtaaattcatcactaaggttagcatgtaa
tagtacaaggaagaatcagttgtatgttaaatctaatgtataaaaagttttataaaatat
catatgtttagagagtatatttcaaatatgatgaatcctagtgcttggcaaattaacttt

Exon 13 +      63258      63329   0   Internal     72    88        Good
cctagtgcttggcaaattaactttagaacactaataaaattattttattaagaaataatt
actatttcattattaaaattcatatataagatgtagcacaatgagagtataaagtagatg
taataatgcattaatgctattctgattctataatatgtttttgctctcttttataaatag
GATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTA
GTGATGGAGAAT
gtaacagccttctgggaggaggtcagaatttttaaaaaattgtttgctctaaacacctaa
ctgttttcttctttgtgaatatggatttcatcctaatggcgaataaaattagaatgatga
tataactggtagaactggaaggaggatcactcacttattttctagattaagaagtagagg

Exon 14 +      69883      70065   0   Internal    183    96   Excellent
ctagaaaccgtatgctatataattatgtactataaagtaataatgtatacagtgtaatgg
atcatgggccatgtgcttttcaaactaattgtacataaaacaagcatctattgaaaatat
ctgacaaactcatcttttatttttgatgtgtgtgtgtgtgtgtgtgtgtttttttaacag
GGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAAT
GGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGAT
ATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGC
AAG
gtagttcttttgttcttcactattaagaacttaatttggtgtccatgtctcttttttttt
ctagtttgtagtgctggaaggtatttttggagaaattcttacatgagcattaggagaatg
tatgggtgtagtgtcttgtataatagaaattgttccactgataatttactctagtttttt

Exon 15 +      80705      80896   0   Internal    192   100   Excellent
gtatcttttgtgcatagcagagtacctgaaacaggaagtattttaaatattttgaatcaa
atgagttaatagaatctttacaaataagaatatacacttctgcttaggatgataattgga
ggcaagtgaatcctgagcgtgatttgataatgacctaataatgatgggttttatttccag
ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCAC
AGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAA
AATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGC
CAACTAGAAGAG
gtaagaaactatgtgaaaactttttgattatgcatatgaacccttcacactacccaaatt
atatatttggctccatattcaatcggttagtctacatatatttatgtttcctctatgggt
aagctactgtgaatggatcaattaataaaacacatgacctatgctttaagaagcttgcaa

Exon 16 +      89604      89629   0    Initial     26    69    Marginal
agaaaggggtatattgtgagatctgaattgggagaggacagttatatccagacctttata
tgctccagtaagaagactgaactttacactgggggccatgggactcactgaatggcatta
aatttgagagtggtcatatgaccagatttgcattttacaaagattgtcattgactgcaac
ATGAAGTATGGAGTATTGGAGGAGCG
gtaaggctggtggcagggagataatttaggaggctttaggtgagggatgataatgacttg
ccaggtaggaaggagtaaatttcttctcagtggataattagaagattgaatggatggact
tggtcactatttggtatagaaggggaaaaaagatgtcaaagatgatgccaatttttaaaa

Exon 17 +      90580      90614   0    Initial     35    43    Marginal
tagtataagaagactggactgaggacagatttccaaggaatttcaatacttaagaggtac
gcagagaaaagaggggctgtgaaggacaccaaggaggagactaagagccaggagggaaaa
ctttcaagagagtattgcattatggaagggaagaagagagaacattttaaatgatacgca
ATGCTCAATAATGGTATCCGCTTTGGAGAGGCCAA
gtaagattcctaagtacccattggatcaaggtccttaatcttacaaaaacttatgcaaat
caataataaagagatgataacccgataatcaaaaatagacaaggcatataagaagaaaat
gaattaaaaatattcaaagcattcaacatatacaaatgcgctcaatctgatatataatga

Exon 18 +      94580      94712   0   Internal    133    65    Marginal
taacaacttctggtttgtttggtccagttgaataatgtaagcacttaaaaaaatgaaatt
ataaacatttatgtgaaaagtgcatatatcacattggatatgttgttatgcactccttaa
taataaagtaagttaatctttattgcacacttattataatattactttgaccctctctag
TACTCTTTATCTAAGTATTCTCAAGTGCTTTACAATCTCAAACAGACCCAATGTGTTGTA
TACACAGAATCCTTTGAAGCTGACATTTGCCTTTCTGACCAGCTTGTTGTAAAGGAAATC
AGCCAAAAAACAA
gtatctagatgagtagctcaaacattagtacacatagtaatcacaggtcaaaatgcagat
agattaccctgtccaaattctcctgagtaagagtaggtgaaacatttttaaataagctcc
ccaggtgattctgaaattggtccaaggaccacatattaagaactaatgatccaaacaatt

Exon 19 +      98414      98494   0    Initial     81    42    Marginal
agatatgtgaacagataagaaaatggatgacaggagaacagaaacgcatgactgtcagag
aagtcattggagactttacagaggaaattaaatttttattgatcttgaaagagtttgcca
gatgaagtagaggacaggcattttagacaaagggaacaggaaatgtgaaaacacaaagtg
ATGGAAGTCATGGTGAGTTTGGAGAACTATAAAACTTCAATGTGGCTGAAGGGTAAGGTG
GATATAGAGGAGTGCTGGGAG
gtgaggctgaagaaataagctaggaaatgtctttttatgccattttttaaagtttggact
ttattctgaagttcacatggatccaatattttttgttttgtgttgttttaagcagaagcg
tgacatgatcagcttgaatgatgaacaacttgaattgtttaaagtggatcacacagtcta

Exon 20 +      98610      98696   0   Terminal     87    64    Marginal
gtttggagaactataaaacttcaatgtggctgaagggtaaggtggatatagaggagtgct
gggaggtgaggctgaagaaataagctaggaaatgtctttttatgccattttttaaagttt
ggactttattctgaagttcacatggatccaatattttttgttttgtgttgttttaagcag
AAGCGTGACATGATCAGCTTGAATGATGAACAACTTGAATTGTTTAAAGTGGATCACACA
GTCTACTGTTTTACAGTTATTCTTTGA
ccaagatattctttattaactgaggaaaaaaagggctttcctgaattttgcagtcatggg
atatatgataagcattcttgatttatcatcttcaatcctgttacataacataataaccat
tgttattacctttagcaatgctttcctcagtattatctaatggcctataaaatgtgactt

Exon 21 +      99499      99564   0   Terminal     66    87        Good
catgtacatatatgcatgtatattcaattgtatatgtgtatatagccaagttattgtaca
gttgacctttgaacaacacgggtttgaactatgcaggtccacttacacgtattttttttt
tccgtttctgacacccctaaggcaacaaggccaactcctccccttgctcttcctcctcag
CTGACTCAACATGAAAACTATGAGGACGAAGACCTTTATGAAGATTCACCTCCACTTAAT
GAATAG
tacatacatttctttttccccatggttttcttaataacattttcttttctctagcttgct
ttattgtaataatatagtatataatacatataacataccaagtatgtgttaattgactgc
ttatgttatcagtaaggcttctggtcaacagtagactattgctagttaagtttctggtag

Exon 22 +     108979     109073   0   Internal     95   100   Excellent
atgttgtttttgaccaactaaataaattgcatttgaaataatggagatgcaatgttcaaa
atttcaactgtggttaaagcaatagtgtgatatatgattacattagaaggaagatgtgcc
tttcaaattcagattgagcatactaaaagtgactctctaattttctatttttggtaatag
GACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTG
AGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAG
gtgaataactaattattggtctagcaagcatttgctgtaaatgtcattcatgtaaaaaaa
ttacagacatttctctattgctttatattctgtttctggaattgaaaaaatcctggggtt
ttatggctagtgggttaagaatcacatttaagaactataaataatggtatagtatccaga

Exon 23 +     113207     113945   2   Terminal    739    64    Marginal
cagagtacttatagaatcatttaaaatataataaaattgtatgatagagattatatgcaa
taaaacattaacaaaatgctaaaatacgagacatattgcaataaagtatttataaaattg
atatttatatgtttttatatcttaaagctgtgtctgtaaactgatggctaacaaaactag
GATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCA
TGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTT
TAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTC
AATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGAC
AGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTC
TATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACA
AATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACC
AGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCAC
GCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGG
TCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGC
AAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAAT
AAGTGAAGAAATTAACGAAGAAGACTTAAAGGTAGGTATACATCGCTTGGGGGTATTTCA
CCCCACAGAATGCAATTGA
gtagaatgcaatatgtagcatgtaacaaaatttactaaaatcataggattaggataaggt
gtatcttaaaactcagaaagtatgaagttcattaattatacaagcaacgttaaaatgtaa
aataacaaatgatttctttttgcaatggacatatctcttcccataaaatgggaaaggatt

Exon 24 +     127915     127994   1   Internal     80    72        Good
acataattatttagaatgtttggaaagaaacaaaaatttctaagtctatctgattctatt
tgctaattcttatttgggttctgaatgcgtctactgtgatccaaacttagtattgaatat
attgatatatctttaaaaaattagtgttttttgaggaatttgtcatcttgtatattatag
GTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTA
CCATATTTGACTTCATCCAG
gtatgtaaaaataagtaccgttaagtatgtctgtattattaaaaaaacaataacaaaagc
aaatgtgattttgttttcattttttatttgattgagggttgaagtcctgtctattgcatt
aattttgtaattatccaaagccttcaaaatagacataagtttagtaaattcaataataag

Exon 25 +     131739     131910   0    Initial    172    57    Marginal
atggcacatgtatacatatgtaactaacctgcacaatgtgcacatgtaccctaaaactta
aagtataataaaaaaaataaaaaaaagtttgaggtgtttaaagtatgcaaaaaaaaaaaa
agaaataaatcactgacacactttgtccactttgcaatgtgaaaatgtttactcaccaac
ATGTTTTCTTTGATCTTACAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCA
GTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTG
AGAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGAAG
gtatgacagtgaatgtgcgatactcatcttgtaaaaaagctataagagctatttgagatt
ctttattgttaatctacttaaaaaaaattctgcttttaaacttttacatcatataacaat
aatttttttctacatgcatgtgtatataaaaggaaactatattacaaagtacacatggat

Exon 26 +     134168     134288   2   Internal    121    50    Marginal
caacaggcacaagagagtcagctgcagctcttcttcttgagtctatatctgtcctgggtc
cattcctttttgtggttgcttcattcctttctctctctgaagactggtttttctggtcta
ccagggctatgccacattgactttatgtagtgtctccattctggcctcctgaatttacag
GAGAGTTCCTCTGTACAAACTCAAAGTCCTGGAGAGAACAGAAAACAGCTTCCTTTTGGC
TCAGGGGTCCAACTGCAGTCTACTCTGCTGCTATGAGGATAGTGGGTTCACCACCTTTGT
T
gttctctcagctagggcagtgggaaatgactctatgaaaggaatatacatgggcaggcaa
atgtactaatcctcatcagtactgtaattttaagcaactttaaaaaattcttttaagtta
tttgaaaataagatcaaagaaggctgaattacataaatgaagatttgttaacaattaatt

Exon 27 +     135820     135954   0    Initial    135    46    Marginal
tttgatttaaaatcctggttgaatacttactatatgcagagcattattctattagtagat
gctgtgatgaactgagatttaaaaattgttaaaattagcataaaattgaaatgtaaattt
aatgtgatatgtgccctaggagaagtgtgaataaagtcgttcacagaagagagaaataac
ATGAGGTTCATTTACGTCTTTTGTGCATCTATAGGAGAAGGAGAAGGAAGAGTTGGTATT
ATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCTGTAAACTCCAGCATA
GATGTGGATAGCTTG
gtaagtcttatcatctttttaacttttatgaaaaaaattcagacaagtaacaaagtatga
gtaatagcatgaggaagaactatataccgtatattgagcttaagaaataaaacattacag
ataaattgagggtcactgtgtatctgtcattaaatccttatctcttctttccttctcata

Exon 28 +     138114     138181   0    Initial     68    40        Poor
catcttgtggcattgaaggatctttgcaaggacctattgtgttataatacagtctatgaa
aaatatcaatatttgcatttgatcacatttaaaaaaatcacattcttttgtttgaatatc
aaagctaatatgtgagtgatttccctgccaaatagcacaagtagcctttcctgggtgttt
ATGGGCATTTATCTGGTTAATGATTCCCATCATAGTGCTGTCACCCATGCCATTGCTAAA
CTTATACA
gtaacttttttgttttcacctcagcatatgttgagagtaggaaatagataggactatgcc
ctcaaattttacgtttatatgatgttaatcctaaaggtccttgtgacttctgaagtaaaa
actcagtgttgtcattttacttactgaattgttagctgagtttagagttgagtttacaat

Exon 29 +     144620     144704   2   Terminal     85    67    Marginal
tcattgtgtcattggttgggtctcattttggcttcatcttctatttctcaaagtctaaga
aaagtgctcctacggaagtgggtgttggctatcatgagactttgctgctggcaggccagc
ttgctgctctagacagagatatccctcgatcctccttggacaactcttttctgtgcacag
GAAGCAGCAGGCTGGGGTTAAGGAGTTTGCCAATCCAGTCATTCTGATAATTGCTGAATA
TGAATTTCTATCCAGCACAATCTAG
gtagctacaatggcacagtagtttttatgtatcaggtgaaaatgtttaataggcactcta
aatgagagaaaaggttaagtgaggttaaaagctcaatgaaaacaaatagatgagactaaa
aatagttcaataggttgtaacttccatctcatccaaacagcaatgaatattttgaggctg

Exon 30 +     146514     146601   0    Initial     88    54    Marginal
ctttttcttcctgtcagaaaatgttctcacccactgaattgaatgactgtctgctcatat
gctgtgaatgagtgcccagtcttaagattaaatcacacgttcttggctatgcatatttgg
gcatgctgtggggagttataataggctgtcttagagtcacattaagcagctagacagaca
ATGAGTTGGAAAGTTACATTTTCTAAATTTGATTGGTACATTCCATTTGTCACATTTGAC
ATTAGAAGTTCTGGATTCACCCTCTATG
gtgagcttcactaatggagaatgtaatttgcaatgctcaaacacaagtcctaaacagaaa
acattgtatgttacattccagtgctaccaaaatagtggttttgaaagtccttattttcta
atactactatgtgtaattttgagtcatttagatagcaacagttaaatgttttatagattg

Exon 31 +     148810     149012   1   Internal    203    97   Excellent
tgaaaagcccgacaaataaccaagtgacaaatagcaagtgttgcattttacaagttattt
tttaggaagcatcaaactaattgtgaaattgtctgccattcttaaaaacaaaaatgttgt
tatttttatttcagatgcgatctgtgagccgagtctttaagttcattgacatgccaacag
AAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGA
TTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTG
TCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCT
TCTCAATAAGTCCTGGCCAGAGG
gtgagatttgaacactgcttgctttgttagactgtgttcagtaagtgaatcccagtagcc
tgaagcaatgtgttagcagaatctatttgtaacattattattgtacagtagaatcaatat
taaacacacatgttttattatatggagtcattatttttaatatgaaatttaatttgcaga

Exon 32 +     153840     153896   0    Initial     57    40        Poor
ggtgggcgtgtgttgtgtgcctataggcccagctacttaggagactgaggcaggaggatc
gcttgagcccaggagattaaggctgcagcgagctgtgatggcaccactacagcctggatg
acagagtgagacactgtctcaaaaaaaaaaaagaaaaagaaaaagaaaaaagaaaggaaa
ATGAAAAAGAACGCCATTAGGTATAAAGGAGCAATGGTAAAAGACCAGTTGCAAAAG
gttagggaatgggtggttactgaaataagaagctatgtagaacactagtgttggtggcag
gaagtagaaagcaagagcactgctctgtgggggatggtcatagcaaatgcaatatggagg
catttgcctctgcactgaggagaaaactatcttttccaagataggaggaaaggagataag

Exon 33 +     155774     155833   0   Internal     60    51    Marginal
agcaatttgtgtcacatcttttattttgctttgttagccaggctagagatatctctattt
ttgatgtttttgatgaaccaactttttgttttattgattttctctgttgatttcgtgatt
tcaatttcatgatttttaaattatgcttacatttgatttaatttgatcttcttttgctag
TTATCCAAGGTGGAAGCTTATATTGTTAAGATCCTTTTGCATTCTTATGCATTCAATGAT

gtaaatttccctctaagcactgctttttctgcatctcacaaatattcatgagttgtattt
tcatgttcatttagtttgaaatatttttaaatttctcttgatatttctcttttgacccat
gtgttacttagaagtgtgttgtttaatcaccatttttaaaaattttctagctatctttct

Exon 34 +     163680     163835   0   Internal    156    67    Marginal
atatatcaacattggtcaggattgaaagtgtgcaacaaggtttgaatgaataagtgaaaa
tcttccactggtgacaggataaaatattccaatggtttttattgaagtacaatactgaat
tatgtttatggcatggtacctatatgtcacagaagtgatcccatcacttttaccttatag
GTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGA
CTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTG
CAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAG
gtgagcaaaaggacttagccagaaaaaaggcaactaaattatattttttactgctatttg
atacttgtactcaagaaattcatattactctgcaaaatatatttgttatgcattgctgtc
ttttttctccagtgcagttttctcataggcagaaaagatgtctctaaaagtttggaattc

Exon 35 +     164132     164252   2   Internal    121    75        Good
tgtcttttttctccagtgcagttttctcataggcagaaaagatgtctctaaaagtttgga
attctcaaattctggttattgaaatgttcatagctttgatagtgtttttcagaagaccaa
atttacagtgggagccttgggcttttgttttttaacagctcttttttgttcctgcttcag
TGGCCTGACCTCCAAGTTAGCAATCGCCAGGTTGAGAAATGCTTTGCGAGACATAACAGA
TGCTCCTGAAATAACAAACACTTGGAATCATGAGGTAGTGGAATTGAAAATAGAAAGTGT
A
gtgattgttttttgttatttggatgggatgaacaatgtcagattagtctgtaactatttt
tttttaatgtcactctgatttggtcacaaaggatctctagtctcattgccttagtatcat
tctacgaattagaatgtgttactgtgtaagagcacttcttgtatatgagagaaatagcaa

Exon 36 +     167817     167908   0    Initial     92    95   Excellent
tgtagattttagaaatgtgggggcatgaggatgtggagagggtattccaggatgccagac
agggagattatggataagtactaagatgagaactagaaaaagctgaggggcaaaaggtca
gaggaggccacaagttagggagtattaggaaaaagaagttaatacttgacaagtgccaac
ATGGCTTCACGAGGAATGGGTTGGGCCTTTTTGAGTGAGGAAGAGGCTGGTGAAAGGGTG
GTGGAGGACACTGCTGCTGCTGATGGCATGGG
gtgtaggtggcaggagaggcagggacatgagctaggaaactctccagctatgaagtgatg
agtctggagtaatataaggacagtaggggtggagtgctgaacttaagggaggagagaaaa
ataattggtatggaagtaggtacaatgcaattttattatttctgagcctaaaaatgtgaa

Exon 37 +     174083     174232   0   Terminal    150    90   Excellent
gaatgatacaaagcagacatgataaaatattaaaatttgagagaacttgatggtaagtac
atgggtgtttcttattttaaaataatttttctacttgaaatattttacaatacaataagg
gaaaaataaaaagttatttaagttattcatactttcttcttcttttcttttttgctatag
AAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGT
GATCAAGAAATATGGAAAGTTGCAGATGAGGTAAGGCTGCTAACTGAAATGATTTTGAAA
GGGGTAACTCATACCAACACAAATGGCTGA
tatagctgacatcattctacacactttgtgtgcatgtatgtgtgtgcacaactttaaaat
ggagtaccctaacatacctggagcaacaggtacttttgactggacctacccctaactgaa
atgattttgaaagaggtaactcataccaacacaaatggttgatatggctaagatcattct

Exon 38 +     180777     180926   0    Initial    150    62    Marginal
gtcagggattatatcctattaattgttgtatttccagtgcctagagtagtcttgcataca
tggatggtattcaataaatattggttgaatgaataaggagttctttcatttcatatgtaa
tagatcatggaaatagccttgtgattgatacacagcaggtattaccatcctcactttaga
ATGAGGACTCAGAGCCTTGAGATGTCTGAGGGCCTTGACTGGGACAGCTGGCAGATGCAG
GAGCAGAGCTGCATCACCCCTGTGGGCTATCTCAGGGTTGTCTGTAATCTAAGTACAATG
TCTGTTGATTTTGGACTGAAGGCTTTTTGG
gtaattgtttgctttttcaatacttataaaatagtttccatccttactcattgatagtaa
ggttagttattttagaaaacaagctaaatagcagaaatagtggccttttaagttgaaaat
ttaccctgaaaaatctacagagtagcaaacagagtatcaaaaggagttgactgtatctat

Exon 39 +     183750     183810   0    Initial     61    59    Marginal
ctgaagagcacgtttttaccctcaagaagcttacagtctaacgagggaacttgcacaaat
actactatcactaggtgcctggttgaatggcttaagagatgatcagggatattcagaagg
atatgtcaggctcagcaatggcatcacttgagagcatcaaggtgtttagggaactacaag
ATGTTTGGTTCTGCTGGGAATAAGAGTGAAGGGGGCTCCATTTGGATGCCTCATACACCA
G
gtgagagatcttagattttattccaccaggaggagaactaccataggatttaaaacagaa
atgatatggtcaaacctacatcttaggaagatccctggggtgtttgtatggtggacttgc
aatttgactaattgagatttgtaggatgattcttaagagatgatgatgacccagactggg

Exon 40 +     185927     186099   0   Internal    173    94   Excellent
tgagctgtcaaggttgtaaatagacttttgctcaatcaattcaaatggtggcaggtagtg
ggggtagagggattggtatgaaaaacataagctttcagaactcctgtgtttatttttaga
atgtcaactgcttgagtgtttttaactctgtggtatctgaactatcttctctaactgcag
GTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGAT
GGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCTC
AGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGT
gtgagtttcagatgttctgttacttaatagcacagtgggaacagaatcattatgcctgct
tcatggtgacacatatttctattaggctgtcatgtctgcgtgtgggggtctcccccaaga
tatgaaataattgcccagtggaaatgagcataaatgcatatttccttgctaagagtcttg

Exon 41 +     186522     186597   2   Terminal     76    58    Marginal
gaagcttttaaatacatgggcctaatctgatccttatgatttgcctttgtatcccattta
taccataagcatgtttatagccccaaataaagaagtactggtgattctacataatgaaaa
atgtactcatttattaaagtttctttgaaatatttgtcctgtttatttatggatacttag
AGTCTACCCCATGGTTGAAAAGCTGATTGTGGCTAACGCTATATCAACATTATGTGAAAA
GAACTTAAAGAAATAA
gtaatttaaagagataatagaacaatagacatattatcaaggtaaatacagatcattact
gttctgtgatattatgtgtggtattttctttcttttctagaacataccaaataattagaa
gaactctaaaacaagcatttgctgattgcacagtaattctctgtgaacacaggatagaag

Exon 42 +     188147     188347   0   Terminal    201    84        Good
aacctccttagagcaaaaggacacagcagttaaatgtgacatacctgattgttcaaaatg
caaggctctggacattgcattctttgacttttattttcctttgagcctgtgccagtttct
gtccctgctctggtctgacctgccttctgtcccagatctcactaacagccatttccctag
GTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGG
AGCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAAC
TCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAG
GTGCAAGATACAAGGCTTTAG
agagcagcataaatgttgacatgggacatttgctcatggaattggagctcgtgggacagt
cacctcatggaattggagctcgtggaacagttacctctgcctcagaaaacaaggatgaat
taagtttttttttaaaaaagaaacatttggtaaggggaattgaggacactgatatgggtc

--------------------------------------------------------------------------------