--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34491 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1109       1204   0    Initial     96    81        Good
gctggggctggggctggagcccgccgtcccaacaatcccggggacgagagttgggcggga
atccgctccacgcaactcggcgcggtcccggggacgtggcgctttccagccaatcccggc
tatgcgattgttagaccaatggctactcggggacgctatgcgacagcggcgggtttgctg
ATGATTGGTCGGGAGGCCGCCGGCGAGGCGGATGAGGGCGGGGTGCGGACCCGCTTCCGG
TTGGGCGGTGCTTGCGCGCGTGAGCTGAGCCGGTGG
gtgagcggcggccacggcatcctgtgctgtgggggctacgaggaaaggtaagtacggtga
tgcccagccccttcaccactgcctcatctttattcgctttctttctgtccccggtcttgt
tcttggcgcggcaggggactgcctcactcggtgccgctgtctctgctggcgcccgggtcc

Exon  2 +       6337       6454   0   Internal    118    90   Excellent
acatgctccataccaaaaaccatatggttttagataaatctagtacagtttttggtatgg
atggtgttttttgtttttagtgtctatattcataaaacaagagggctttgttaaagtttc
taatagccaggagttgttatatatgtgggcacaaaggacgttttgtttttttttaagtag
AACTTCTTTAAAGTGCAGATTTTTCATTCCTCCCTGCAGAAAGATAAAGAAGTAAAGATG
GACCATTGGCTTTGTCCATCTGGGTCCTTGATGACCGTTGTAGGCAGTTTCATCAATA
gtaaggaagccaggtttcagggtagcattggacagtgaggaagcagaggcagcagggtag
aaactgtgggtgagggaaagggaggagcaagcatgaaggaacagcacagtctgggaaaga
ctgtgggtagtggagacctgagaagcactgattgacagaatggaggagcctgtttaaggg

Exon  3 +      10392      10623   1   Internal    232   100   Excellent
gaagagtctgatattccaccatacttattttatggatgaagtaatatttgggataatata
aaagacttgcatagatatgtatatcaaattaatagtttaactcggatgtgagcttttaat
ttcttatttagttattaagcatactgcctcctgaattaactgcttttcattttcttcaag
ATCTAATTATCATGGACCTGCGACAGTTTCTTATGTGCCTGTCCCTGTGCACAGCCTTTG
CCTTGAGCAAACCCACAGAAAAGAAGGACCGTGTACATCATGAGCCTCAGCTCAGTGACA
AGGTTCACAATGATGCTCAGAGTTTTGATTATGACCATGATGCCTTCTTGGGTGCTGAAG
AAGCAAAGACCTTTGATCAGCTGACACCAGAAGAGAGCAAGGAAAGGCTTGG
gtaaggtaccacctctcaggggtctagtgtgggtaatgacattctttataaaggctaatt
cttttcttttctggctcagttatgagtaaagttatattgaactattaatacatcttctga
aagctaaccatggaattactacctctaaaatttcattaaatgcctgatttcatacatttt

Exon  4 +      16080      16286   2   Internal    207   100   Excellent
ccttattcacgtggcttattacagaccagtaatggaccatttttttcagttgctggcctg
gcagttttgttttggagacaattttttatttctgtgcattagccctgggcacacacctgg
ctaagtccagagttctgtgtctttttaaccttttgctggatttctctgcattttctacag
AAAGATTGTAAGTAAAATAGATGGCGACAAGGACGGGTTTGTCACTGTGGATGAGCTCAA
AGACTGGATTAAATTTGCACAAAAGCGCTGGATTTACGAGGATGTAGAGCGACAGTGGAA
GGGGCATGACCTCAATGAGGACGGCCTCGTTTCCTGGGAGGAGTATAAAAATGCCACCTA
CGGCTACGTTTTAGGTAGGTCCCTACT
gtctgggggaaaaagccttgtggagctggcaccttgaaacgtaactgttttgtcttgtag
aatgattgtagataaaatagacgcggataaagatgggtttgtgacggagggggagctgaa
atcctggattaagcacgcccagaagaaatacatatatgacaatgttgaaaaccaatggca

Exon  5 +      16347      16582   2   Internal    236    91   Excellent
ctggatttacgaggatgtagagcgacagtggaaggggcatgacctcaatgaggacggcct
cgtttcctgggaggagtataaaaatgccacctacggctacgttttaggtaggtccctact
gtctgggggaaaaagccttgtggagctggcaccttgaaacgtaactgttttgtcttgtag
AATGATTGTAGATAAAATAGACGCGGATAAAGATGGGTTTGTGACGGAGGGGGAGCTGAA
ATCCTGGATTAAGCACGCCCAGAAGAAATACATATATGACAATGTTGAAAACCAATGGCA
GGAGTTTGATATGAATCAAGACGGCTTAATCTCCTGGGATGAGTACAGAAACGTGACTTA
TGGCACTTACCTGGGTAAGGGGCAAGATGTCAGCCTGGCAGGGACCGTGGTCTTGA
gtcaaagaaacaaatgggtcacacagtaaaggaaaggaagcttatcttaaatagttcaat
tcagtgctaagctgattccctttattaattttaaatttgtatattatgtatttttaaatt
tgtttaatttttgttttctgaagtctggaagtctggtatcttctacatttttagcatttt

Exon  6 +      20689      20855   1   Internal    167   100   Excellent
tctgatgcctggagctgtagcccaaaactaaatgtctttgtactgctgcagttttacctg
tgtcatcaattatttcttccttgcatggttttatctttattggaaattgatttcccaccc
cacacattttcatgttttctgaaagtcttttaagatttgacctaaatttttgttttctag
ATGATCCAGATCCTGATGATGGATTTAACTATAAACAGATGATGGTTAGAGATGAGCGGA
GGTTTAAAATGGCAGACAAGGATGGAGACCTCATTGCCACCAAGGAGGAGTTCACAGCTT
TCCTGCACCCTGAGGAGTATGACTACATGAAAGATATAGTAGTACAG
gtgggtgagatgaaggattctgaacagggactcagtttctctttttgtggcttattctgt
ctttcccctttagccttatatagcatatcttatatatatatatgctatatagcatatcac
tgtatatgctatataagtattggccagattcagaatccaaggtctgtcactgtttttctg

Exon  7 +      21610      21670   0   Internal     61   100   Excellent
atttcttggctagaaatggttttaaccatacagacacacatgcatacatacatacataca
tacatacatgtacaagtgtgtttaatgaataataaatgtttacctaaactagatacttta
ctttcttctggcaaattcagagaccaacttaatagtctcttcttattctttcctgtttag
GAAACAATGGAAGATATAGATAAGAATGCTGATGGTTTCATTGATCTAGAAGAGTATATT
G
gtaagtctctgcttttagtgtttttcttagaaaagctgagaagctttgaaaggtgtattt
gctggctgggcacagtggctcatgcctgtaatcccaacactgggaggccgaggcgggcag
atcacctgaggtcaggagtccaagtccagcctggccaacatggggaaaccccgtctctac

Exon  8 +      29274      29473   1   Internal    200   100   Excellent
taagtgattaagcctcaggaaaataccttgctttctaaggtctgtctggcctaaaatacc
cttgtagctgctgttgggttccaaacaaatggatgaggaaaaagggttaggccagattag
catgaggcagttttggggaaaagacaaacccttcttttgtatgtatgtctgtgtacccag
GTGACATGTACAGCCATGATGGGAATACTGATGAGCCAGAATGGGTAAAGACAGAGCGAG
AGCAGTTTGTTGAGTTTCGGGATAAGAACCGTGATGGGAAGATGGACAAGGAAGAGACCA
AAGACTGGATCCTTCCCTCAGACTATGATCATGCAGAGGCAGAAGCCAGGCACCTGGTCT
ATGAATCAGACCAAAACAAG
gtaagtctggcgaggcccacacgctctatccttgattgaagtatgcttctaggggatcac
ctgaacagtttctgttaaggtgcatagagcatttaaggtcttaattagtctaagtcagcc
aagtatctgaatctggcgattaaaacctttcagggcagcactagctatctgatctcattt

Exon  9 +      30881      30985   0   Terminal    105    94   Excellent
ttgctgttttcttccctcttcgtatgtatgtagggggaatgagggctgagtagttcacac
ttaatttagtagaaatgagaatcttaacttctgattaaccccaattcttctataacagtg
tttctgaatttttaatgggaaatatgttcttcttcaattcattgctatctctactttcag
GATGGCAAGCTTACCAAGGAGGAGATCGTTGACAAGTATGACTTATTTGTTGGCAGCCAG
GCCACAGATTTTGGGGAGGCCTTAGTACGGCATGATGAGTTCTGA
gctacggaggaaccctcatttcctcaaaagtaatttatttttacagcttctggtttcaca
tgaaattgtttgcgctactgagactgttactacaaactttttaagacatgaaaaggcgta
atgaaaaccatcccgtccccattcctcctcctctctgagggactggagggaagccgtgct

--------------------------------------------------------------------------------