--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (192088 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (38 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2410       2518   0    Initial    109    41    Marginal
gtgggggaattttagtgctgtggcaatacatggtcaaaaaaagtggatgagaacaaagtg
cttgatatttatagatgccttctattaacaggactatgcagatggacttgtaaactgaaa
atccttctaatgtgtttgtcaaaaccagacatatacagctagaacctgagtgaagactag
ATGCTATATGGCAAGCAGGGTAAATCTGATGATTTTTTAGTAGTGCTGGCTATTAAAGAC
TACCAGCTGCAAATGACTGATTCAACTGGATTTTATTCCATGCAATGCG
gtagtttggggttgagattcattaaataaagttttctctttgtatttagaagtttgggga
taattttcttgggaatgcctatttctccttctagaagtgatatatgagaacagaattcct
tgtgaatttccttccctggaacagttctgagtaagtgtgagagaaaagctgcaggcaaaa

Exon  2 +       7522       7662   0     Single    141    42    Marginal
aatgaggccacataaatatcttctaatatttggggtacttttatatgaacatgggagaag
gcatttgtgtttctcaaggcagcagaacagaactgaatatataaattcatagaattttta
agctgggcaagaccttaggagctcattcagcccaaggagtacatataacttttcatctgt
ATGCCAGCTCCAACCAATTGGCATGTTAAGAAGGATTCTGAGGATGAATCTAAGCTCAGA
GGGGAGGGGAAAATGTGGTCACTGATAGTGATATCTGTTGTGGAAGAGAAGGGCCATATC
TACTCAAGTACCATGTTTTAG
tcttcattaatgtggtctgtaggtttttaacctctgggtggtggatccctgggaggccac
aaagtcattgcaagaggtaaacaaatctgtatatgcagcaagtgcttttggcaagctact
ctgagtaaataatatatcttacatcatatgtgctactatttttctaattctatacataca

Exon  3 +      13413      13603   0    Initial    191    46    Marginal
aaacaaaaaaacctgtaaatagtctggtcatcttctcctaactatcatcttggaccagat
tgcatctggagtactagtttattaggcatacccgagactgggtaatttataaagaaagag
gtttaatggactcacagttccacatgattggggaggcctcacaatcatggcggaaggcga
ATGAGGAGCAAAGTCACAAATTACATGGTGACAGGCAAGAGAGCTTGTGCAGGGGAACTC
CCATTTATAAAGCCATCAGATTTCCTGAGACTTATTCACTACCACGAGAATAGTATGGGG
GCAACTGCCGCCGTGATTCAGTTATCTCCACCTGGCCCTGCCCTTGACACATGGGATTAT
TACAATTCAAG
gtgagatttgggtggggacacagccaaaccatatctgatgccacaacaaaatgcacaaac
aaatttatttctggatggaggttagaagtccaagatcaaggtgtcagcagggttggttcc
ttcaagggctgtgagggaagtctctgttccagccctctctgtttcacttgtagatggtta

Exon  4 +      15894      15936   0    Initial     43    44    Marginal
cagatgagccctgagtggactgttcaccccttcagcacctctacccagagactagaacaa
tccctacaccacgcaagcagccatgcctgttactgttacggaggcatgttctgtgtatgt
gtctaggctcgcacgggatgcatttcctataggtgtacctatgtacactagagttgaaaa
ATGATGAAAGCATATGACCCGAAAGACAAAAAGAAAGTGACAG
gtgagctaactgtgcattgcctttgttatgacttcagtaatctggatcatcttatcctct
aaagaaatgtataccaaaggcctagcaatggctgccataggttttttgttgttgttgtca
attgaaacagagtctcactctgtcgcccgggctggagtgcagtggagcaatctcagctca

Exon  5 +      17334      17441   0     Single    108    54    Marginal
ttcccttccttccccctcctccttttctttctttctcttcctcctcattcttcacattct
tccagtttttgtttcttctcccactgagattgatatggctggaaatgtgctattatgatt
gggcagccttgtgctttatccatggtggcctatagctctcttgcttatatatatcttttt
ATGAAGATCGATGGTAACAAAAAATACTTCACCCACACTCTGCTGGGAAGATGCGACGGT
GGAATGGAAATATCTATCCAGAGAGCTCCCTACGACCCTAAGACTTGA
cagagtcatccccagccagcctggagccactgacccacctgtgtctgagtaactgggaaa
caaggagtgtaggagtttgagagttatttttgttttttacttttttaaactttcatgcct
ttccatatttctgctcttagatattctgttaaaataaaacaacggctctttccatgggag

Exon  6 +      32732      32798   2   Terminal     67    66    Marginal
atacctccaccacttccttattgccccagtgagaataaatggttctccttttgggttgcc
acagcacaaacctccgtgtattatatctgaccaatagggtttactactctcatctcccta
cttcattaaaaggcaagaacaatttttattgatccttgtatatcctgccctcaattctag
TGCCGAACACAGCATCAAACACAAAGCAGAGGCTCAACAAATGCTGAATCGAACTGAATT
CAATTAA
ttgaagaaagggttgtttactgacactgtactaacacttctaatattatcctgcctcact
agggagtcttcactgggggcaggggtctggagtacaatcagaatcaactggacagttttc
caaactatacaggctaatggtagtggactgtgttaaaaagctattcaggatactccgaaa

Exon  7 +      35472      35600   0     Single    129    54    Marginal
ggtagcactaaggacccagttgacattactggtaacaaattttaagtaaaagcacttagc
ttagctgcgtgttttcctccagctggatttagcttcctgtctgcttgctacatggagagc
agtgtttagagtgatgaatcaggggatgtcagctggtaaaggacggtgggtggctgaggc
ATGTGGGAACACAAGATCATTGGAGGACAGAAGCCCAAGGAACTAAGAGGCCAGGGTATT
AGAATGATCACAGACATGAATGTTGAAATCGCTGAGAATTATGGCAGAAGTAGCATTGGA
AAGAGTTAA
aaccaggagctaacatctagaaatgaagggaagtaatgcagggatcaggaaatgactgca
acaaggaggggtagaggataatattttcaggaaggaatatagctgtggagcaaggagaca
attgcgtctacttccaggctctgtgatacaaagggtatggaagctgtcggaagagctata

Exon  8 +      38995      39048   0   Internal     54    52    Marginal
ttagaaaggacttttttctttatttgctctttttgaccactgacatttattttaattttt
ttcatttttaaacatttttattttgaaataaagtaaaagattaacaggaagttacaaaat
agtatagaaaggtcccaggtacccagttttccccagtagtaacatcttgcataactacag
TGCAATACCAAAACCCAAGAAATTGACATTCGTGTGATTCACAACGTTATTCAG
gtaagaaggtctttttaaaacaagaaataattcattacaaccacggggttcctctaaaaa
ctgtccctttaactgaagaacacctgattgtttgttgtttattcagtacttctccacatt
ttgcagaggcacacaaaatcatttttataaatcccaacctatgaaggacagaacaaagtc

Exon  9 +      48284      48531   1   Terminal    248    47    Marginal
tagtgtcaccatgacttaaaattgaggtcttttaccacgaacactgttgcctgaattccc
taaactatcatgataacagacattttactgataatattggttttgtattgttggttcatt
gttcctaagtatgaaacctggatatgcccaaattgttcctggattattctttcatttcag
ATCCAAATAAAATAATTGGGGCCTCCATCTCAATATTTCTGAGAATCCCCAAGAAAGAGA
TAAGGTGGTGGGATGCCTTATATTTTTGTCACCTCCTGCTCCAAATTCCAGTCACCCATT
TACCTCCTCAGTCCAACCTCTACCTGCTTAACTCTGAGCATGGAAAAGTTCTTTTTTTCT
TCATTCCCACAAAGCTGCTGCATTTAACAGACTTTGATGAATGGTTTATGGTGATAGAAG
GGCATTAA
aatgcagcccacactggatcacagctcaaaattaaatattttaatttgagaaaaaaatta
actctttagctctttgccttaattctctcccatgtgattttggagtggacagggccattc
aacttttacaaccacaaagcaaggtcaggatatttatgtaaacaaaatacaatagttatc

Exon 10 +      57968      58210   0     Single    243    41    Marginal
catgagggttctaatcttcatagttgcttctgtttgataagttctatttatttaggaagc
catacacaggaacacaggcagaagagaaccagaagactgcatccattggaaaatttaata
tacataaaaattaagtgcaccatttcttatcacttgctgaaacttaggtaacttaacatc
ATGCCTTACAAACAACAGTCAGTGCTCGTTGATAATGATGACAGTGGTAGTGGCAGTGGT
GATGATTACGATGATGAAGGCAAGAGAAACAACTGCCACTACCTTTTCACAAACTTTGGA
CTTTTTATTATCTACACTAGGTCTTTCGTGATGAGTGGTAGTTATACCCAGCTCAAACTT
CAGGTACACTATGACTCTGTGAAGAGAAAGATACATTTTTCTCAGTGTCTCTCATGCCTG
TAG
ccacgggaaacttatcaaacactgacgtcagctactttcccatgagaagttcagaaattt
cataagaccgcaaacgactttctctttcctatttgcttcagacaagtacagaacttttca
tgaagcttaaaaataaacatctgaccttcatggatacattctcattgcttctccaatcag

Exon 11 +      65441      65518   0   Terminal     78    69    Marginal
ataactgtattttccttaaaatgcaaatgcacaatagctatttctacccctgccttactt
ctccctttagattctaactaacaacagtacttgaggaagaaatgatatttgaaaatatat
agtctgtattagctaaaattcattcaactgaattatgtttccatcctccttttattccag
GTATCATTGGAACATTTCAAGATCATCAAATCAAATTCCACAGGGATTGGTGACCAACCA
GAAGGCTCAGACATCTGA
ttgctgacctgtgagtaaagtttatgttttattaatactttgggctctgctcttaggaat
tacacagcctctgtgcctgatattctaaattcttacatctgaagatgcactgtgagaaac
cagtttttctgctgtggccctcctactttacttgccagttaattaatcagttagaatcta

Exon 12 +      65875      66014   0    Initial    140    89        Good
tctatcaagttttgaaggatctatcaagtcttttatcctgttttgtaatctgattttttt
ttttgctttatttttaaatgtttcctgcaatgtaatatctttcacaaaacagtcctggat
caatcatgaagtcttcacttcctgtgaaaaatgctagtgacttgaatcaataaagacaac
ATGAGTCAGCCTTCCAAGGTGAATAAGCTCACCTTTGTGCAAACACTGGTGATCTCAGGA
GTGCTAAGTACCCCTCACTTTCAACAAATCTCTCTCACCTGGGAGGAAAACTTCTACCAG
AACAAGGACCACCTAGGGAG
gtgaaagaggggatttccactttagaggatggagaaaccaaagggcatttcactcattca
cagttttgctgagcttggctccagtaggtagaaaagttcttcaggagttcagcacaccac
tcaggcaattgttgtttcaaaattctatctgttgcccccatgcaagttttctcaggctac

Exon 13 +      73815      73901   1   Internal     87    67    Marginal
gtcaagagaaagtgatggtacaaaacatttgaacagcaaggccatatagtattgatcacc
aagaacaaggccaataattgctgtagaagctgaaagggagggtggttctgggataaagat
aggacttgagctggactctagaaaaatataggggatttgcaggagtggagggcacttcag
GTTATGGGCAGCAAGAAGCCAGAGACAAAGGCCCAGAGGCAGAAATGAGGGTGAAATTAT
TGCAGGATTCAGGAGTTTGGCTTGGCT
gtaagttgtgtttgcatgggagggtagggtggggagaggaatcatgtgatggatagagtg
gagccatttcacagtgagtttctgggttctgcagagaaacaagatggtggtatgtgggag
gaagatcatttttcctgaataactccattcaaaaccaaggaatttgcacctcccaatcac

Exon 14 +      78295      78449   1   Terminal    155    55    Marginal
ttccaaaggctgcggaaatttgaagtgtatcagctgaattctgattctcttcttttctta
ttcatcctgtcttctttttctttcaacatccaagaacaaacctattccctcagttaaatg
cctaatactcctcttcctgaaatcgaaatgtctctctaagaccaagttcttttccactag
AGAAAAACAACCACAACTACAAATCAGAATATAAAATAGAGTTCCATAGTAAACCACCAC
CATTCCCAAGGTTACTAAGAGCTCAGCCAGAGAAACAGCCTTTTGATAACGTCTTAGCCA
AGTTCATTTGTTTAACAACTAAGTTCAACAAATAA
acactgccctggcatctgttccaactcaacaagtgtgagcctaatgcggagtataagaaa
aacagtcagttaagaactttgagggatcacgaaagacagtaatcatttctaagagataac
aaccttttacagaagacaaatatgtacttggtaattaaaatacaagctatagactaagtg

Exon 15 +      83020      83074   0    Initial     55    42    Marginal
gtgaaggaaaacagttaaagggtcaaggtaagcgatgatcattgcagatcagaggtagga
aatctgctggagtatgttgtacccagaaatcacccaatacctgtaggatgaagagaaaca
tcactgagttgcagcgatggcccaactgaaatgaatgcaaatctttaggatatacacgac
ATGCTCCCTTTCTCCCACAAAGCACTGAATCTCAAGAACACAAAACAGAAAGCAG
gtgataggtgtgattcaaggttgaagatgggtgtgacaagcctggtggaactttaaagaa
gcaagaaagtctaaactatcaattccaggaaggcaaagaccttttctgtcttgttcactg
ttataccccagtgtcgagaacagtacctggcacatagtagctgtgcggtaaatatttatt

Exon 16 +      89061      89163   2   Terminal    103    73        Good
ctcctcctttgttcactttttcataactttggtctggggttcagaaagttacaaagagca
aaatcattcattagaatttcaagtgattctaccaatatttcaagtcttcaaaacctctct
gtctccggaggtcttttttaaagaataaataatcttgggatcttacttatttgtctctag
GAGATTCATGAATGAGACTGAATTTAACTCGGCTCAGGAGTCAGAAATTGATCACTGGCT
ACCTTATCAGCTTTCTAAGAGTAAAGAAAAATCAGGAGAATGA
caaatgggaaagagggcccatagtaactcaggagaagtaacacactgagttatcaatgat
attgactctacctcctctctttcaggtccagacatcatctggtctccctgaacctgaaat
cacaccatggatgattttgagcgtcgcagagaacttagaaggcaaaagagggaggagatg

Exon 17 +      89249      89360   0   Internal    112   100   Excellent
tgaatgagactgaatttaactcggctcaggagtcagaaattgatcactggctaccttatc
agctttctaagagtaaagaaaaatcaggagaatgacaaatgggaaagagggcccatagta
actcaggagaagtaacacactgagttatcaatgatattgactctacctcctctctttcag
GTCCAGACATCATCTGGTCTCCCTGAACCTGAAATCACACCATGGATGATTTTGAGCGTC
GCAGAGAACTTAGAAGGCAAAAGAGGGAGGAGATGCGACTCGAAGCAGAAAG
gtaaggatctagggtgaaaaatacttgtattcccttattaacaaccttggtttcaggcct
caaagaccatccttttgagaggccaaatgtggtcatatcgcacaccaaactgttcgcaaa
agtagttatggaaaatttttctgctaagactctaaattaagcatttaaaaaaggaaaaca

Exon 18 +     109516     109613   1   Terminal     98    45    Marginal
gtgtgcatgtgtatgtgtgcgcatgtgtatgtgtgtgcatgtgtgcatatgcatgcattc
gtgtatgtgtgtgtgcctgtgtgtgcatgtgtgtctgtatgtgtgtgtatgtgtgtgcat
gtgtgtcataagcgcattagggcgtatgcacagcacttcccacatacctctcttccctag
GGAATTGTTTCAAGGTAGAAGCTGTTCTTAAACAACTGCTGCAGACTCTAAAGTCTGGAA
CAGATCTTGTGGTCCGGTCTCCCACCTCCATGAAGTAA
agttatttttaaaaaatcatattttcttaataaaggaccaccctgtggtgggagctgttc
ctttctattacagtctgacctccctcaaaccttcccagcccagaatctctttgatgaaaa
attaaacaataaagtgtccagaaacaaaggatactatgagtaatctcagaatggcccaga

Exon 19 +     111743     111844   0     Single    102    54    Marginal
ttcaagcaattctcctgccgcagcctcccaagtagctgggactacaggcacctgccacca
agcccgggtaatttttgtatttttagtagagacggggtttcaccatgttggccaggctgg
tctcaaactcctgaccttgatccacctgcctcagcctccccgagtgctgggattacaggc
ATGAGCCACCTCGCCTGGCCTATAAACTACGACTCTGATGACCGCATAGTATTTAAGCAA
GAAAACAACCAAAATGTTCTAGCTAAAGTGGAGACCACTTAA
cctaacccaattaaactttaagttgaacacaagagtagtagatgcagttcagctccatga
cattgggtgagttgtctaaatgctctgtgctttggtgtccttgtctgcgtgtgacatgaa
gccgcagatctcaaagatctctttcattccgtgaaagcgctctcaatgtgtgaagttgac

Exon 20 +     129726     129800   0   Terminal     75    53    Marginal
cagtttgaattctgtagaacagactgctaagaattgttttttcacagatctctaactgag
ctttaggaatatcatgctgacacagtttatctatgttgaaaaaagataggaatttggggt
tacatgatgttttcattaaaagaggttgaggatataggttaaaatcttctcggtcaccag
GCGATGAAGGTGATACTGGACTTGATCAAATTTAGTCATGGAGAGAACAAGGGATATACC
ATTGGATATATTTAA
cacatgtttaaaaagttttaaacatttatctatgcaacaatattaagtaacacctacttt
tgcttgtaaatatttatattctccaattttaaaataataaaagaaacaaaaagagcctgg
cacttaggatcatagtgatgagttgctcatctatttcctgtctgatcactaaatacctgc

Exon 21 +     132781     132929   0   Internal    149    59    Marginal
gggggttccatctcctgtatttttttctaaaaattcttctgtctccaagcctagctttta
gtaggctgccgccgccactcctcggttggtttaatatggttttgtcatgatgatgaaact
gaaacctgagaggtcatttcctttttcttttttttttttttttttttggtgaatgatcag
GCTTCACCTTCTGGAACTGATGGTCAGAAAGCGAGCCCTGCAGCCCATAGCAACATGGCA
GCAGGTGTAGCCAGGTATTCCTGGTTCATATCCATGAGCCAGTATGAAGTGTCTGCTTTT
AAAGCCACTCACAAAACTTCCAACAGAGT
gtatgtgtgctctgtgtgtgtgcacatgctttggttttggggatgaccttctcccgcctc
tgttactgagagaagataaagctgtaataactttaaacaccatttttgcagtaaatactc
ataagcctagcatagaattgtcagcctttccctacacatggactggagtcatatttcatt

Exon 22 +     142078     142269   0    Initial    192    75        Good
tgtttccaacctacatgaggtttttaactttttaagttggatcccaaattaagacccagg
ttcagacaatgccattagcagaaccaataatgatgggaatcaaataaaagtaattgacta
agaagtcatccttttttgaggctgtgagccccaggcattcttctttggggtgtggccttc
ATGGGGAGTGTATTGCTGCAGAAAGCTGGGGACAGAATAGTGTTCTGGATTGAGTATCTC
AGTTACCAGCCTGAAATCTCCATCGACCAACACTGCCTTCTCTCAAATGACTTCTTATAT
GAAAGTGGACAGACAGTGGAATGCAGAAATTTTAGAGCTGATCTTGGGGACCGGTCAACT
GTCTACTGGCCA
gtaagttactatgaattcaaaaatggtgaacttcaatagcattcattctgtcagatagtg
agtttatttgatctgttggaattttaggtgcagagttctttttcaaaatataggaatgtg
cagaaacaattaaggaaaacagacttggaaactttgatctgaatggagtcctctttaagt

Exon 23 +     147083     147148   2   Internal     66    78        Good
ttctgaaaatagtgggaaattaaggacttaaggttatattccattaaggggacggaggag
ttttgcttttaggataggtgtataagttcgttcttgcactgccgtaaagaactgcccaag
atgggtaatttataaagaaaagaggtttaactgactcactcatagctggggaggcctcag
GAAACTTACAATCATGGAGGAAGGGGAAGCAGGCACCTTCTTTACAAAGCAGCAGAAGAG
AGAAGA
gtgagcgaaggaggaacttgccaaacacttataaaaaccttgagagaattcactcactgt
cacgagcacagcatgagggaaccacccccatgatccagtcagctcccaccacattccttc
ctcaacacctgacacgggggattacaatgcaagatgagatttgggtggggacacaaagcc

Exon 24 +     150304     150520   2   Terminal    217    97   Excellent
aaaagtttgaaagctagctgactaggtcgctaaacttaaggaactgaaccatccttttag
acgtatgtggttcattaagcagtgaagttcagaaaagggctcagggctgttcctgccaag
aggttggtgaagacacgtggcaagtggcacgctcaagaggttgtctttgtaatgttgcag
AATCGCCTACCAGAGGAATGACGATGATGAAGAGGAGGCAGCCCGGGAACGGCGCCGCCG
AGCCCGACAGGAACGGCTGCGGCAGAAGCAGGAGGAAGAATCCTTGGGACAGGTGACCGA
CCAGGTGGAGGTGAATGCCCAGAACAGGTACTGTCCTCTTTGGGACGGGGAGTTTCTAAC
TTGCGTCTTAGCCTGTCCGTTGAATGGAATTTGTTGA
gcagagcattcctttctcagcccaactcaaccctttttcaatctaactggtttaattatt
ttgcagtcattttaggcaactaatctgattagacaggcaatctgatttagacactaggac
acactattctatttctctccaccccgttcccatctcataaacataccccagttgaaggct

Exon 25 +     153372     153419   1   Internal     48    63    Marginal
gtcacagttctggtatcacatgactggttgtttcctgcaaatagaaaccaacaccctggc
ttggacagtgtccagcatcctgcagtagtgagggaggtgatggacaacagtttaactttt
ggagattttctgtcctttttaaaataaatgtcaaatttaactgccctttttccactgtag
AAAAGATGGACAAGAAACCCTTTATTCATGGAAATCTTGACAAAGAAG
gtagattgtgtatacattagttagggtaacgctggctgctataacgattagtgcccccaa
attttaagtttagtgcagtaacacttaccattatgcatatttctgtctagttggtagaac
cagccacctgtcttcttttctcttgtgactctcaatccctagggcttggtgctccctgat

Exon 26 +     153935     154092   0    Initial    158    60    Marginal
gtgatcactccccccaactatggaaggaggagcaggaattgtaagggacacttagatgtc
tcttccattggggtcactggcgtgagtgtggaatctcaacactgtaatgtacattttctt
cctctcaaagtaccttgggagcctccaatccagatcaggaattctagatgacttgatgac
ATGGGAGAATACTACATGACATGGAAGGAATTCACTTATTATTTCAGTTTGATCCTTAAG
TTTGAATTCCCCAAGAAGCAAGTCCAGAAACAACGATTTGACTGCAAGTCGTTTATTTGT
AAGGTGATGCTAGGAAACACTGGTGGAGGTGTGGGAAG
gtaagacagaaaagggaaggccaccaaataaacgttgcatgaccaagcacatcaccactg
tgggtatctggagcttcactccactgggaaactctgagatccagtgtggaatacacacct
cggagttatcccactcaaaaagtgaggggtgctgaggtatctaaacactcaggctatcaa

Exon 27 +     154131     154233   0    Initial    103    49    Marginal
tgacatggaaggaattcacttattatttcagtttgatccttaagtttgaattccccaaga
agcaagtccagaaacaacgatttgactgcaagtcgtttatttgtaaggtgatgctaggaa
acactggtggaggtgtgggaaggtaagacagaaaagggaaggccaccaaataaacgttgc
ATGACCAAGCACATCACCACTGTGGGTATCTGGAGCTTCACTCCACTGGGAAACTCTGAG
ATCCAGTGTGGAATACACACCTCGGAGTTATCCCACTCAAAAA
gtgaggggtgctgaggtatctaaacactcaggctatcaatttttgtttgaaaactgctcc
caggggacattaataccgaaagcacttctggcatgttgagtagactccagtccccagaga
aaggcttgcaaatgctgtcagctgaaagccaggcaggcgtgtactaaaatggtaacgtac

Exon 28 +     154538     155612   2   Internal   1075    92   Excellent
cttgcaaatgctgtcagctgaaagccaggcaggcgtgtactaaaatggtaacgtactggg
gatatgggcaagcttggcactactggcatctgctgtagtcctgggtagcacaggctgtat
gaatgctgctgactgatgaatgagcaagctgtctttggtgttgttctttctgttgtacag
TGTGCCTGACGAGGAGGCCAAGACAACCACCACAAACACTCAAGTGGAAGGGGATGATGA
GGCCGCATTCCTGGAGCGCCTGGCTCGGCGTGAGGAAAGACGCCAAAAACGCCTTCAGGA
GGCTCTGGAGCGGCAGAAGGAGTTCGACCCAACAATAACAGATGCAAGTCTGTCGCTCCC
AAGCAGAAGAATGCAAAATGACACAGCAGAAAATGAAACTACCGAGAAGGAAGAAAAAAG
TGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAACAGTCACCAAGTCCTACCA
GAAGAATGATTGGAGGGATGCTGAAGAAAACAAGAAAGAAGACAAGGAAAAGGAGGAGGA
GGAAGAGGAGAAGCCAAAGCGAGGGAGCATTGGAGAAAATCAGGTAGAGGTGATGGTGGA
AGAGAAAACAACTGAAAGCCAGGAGGAAACAGTGGTAATGTCATTAAAAAATGGGCAGAT
CAGTTCAGAAGAGCCTAAACAAGAGGAGGAGAGGGAACAAGGTTCAGATGAGATTTCCCA
TCATGAAAAGATGGAAGAGGAAGACAAGGAAAGAGCTGAGGCAGAGAGGGCAAGGTTGGA
AGCAGAAGAAAGAGAAAGAATTAAAGCCGAGCAAGACAAAAAGATAGCAGATGAACGAGC
AAGAATTGAAGCAGAAGAAAAAGCAGCTGCCCAAGAAAGAGAAAGGAGAGAGGCAGAAGA
GAGGGAAAGGATGAGGGAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCAGAGGATAAAGGA
GGAAGAGAAAAGGGCAGCAGAGGAGAGGCAGAGGATAAAGGAGGAAGAGAAAAGGGCAGC
AGAGGAGAGGCAGAGGATAAAAGAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCAAAGGGC
CAGGGCAGAGGAGGAAGAGAAGGCTAAGGTAGAAGAGCAGAAACGTAACAAGCAGCTAGA
AGAGAAAAAACGTGCCATGCAAGAGACAAAGATAAAAGGGGAAAAGGTAGAACAGAAAAT
AGAAGGGAAATGGGTAAATGAAAAGAAAGCACAAGAAGATAAACTTCAGACAGCT
gtcctaaagaaacaggtacagtaaacattttgcaccaaatgtgtgatgcctgtgacttgt
gagaaatgtaatgcacatctgatttgggactgaggccacatgcatatagctcacatgctt
gatcatttggcaagctgttcattttttcaggccatagcgatacacaagcatgcagcaatt

Exon 29 +     156224     156271   0   Terminal     48    62    Marginal
tacctcactcatgggtttgacgttgaattaaaaaaatgataaaagctggggtgggaaaga
gacatgaagaataatggtcagacatttcatcttaagaaggcaaaaacaggctgggtacag
tggctcacacctgtaatcccagcactttgggaggctgaggtgggtggatcacaaggtcag
GAGATCGAGACCATCCTGGCCAACATGGTGAAACCCCATCTCTACTAA
aaatacaaaattagctgggtgtaccggcacatgtctgtaatcccagctactcaggaggct
gaggcaggagaatcacttgaacctgggaggcagaggttgcaatgagctgagattgtgcca
ctgcactccactgggcaacagggagagactccatctcaacaacaaaaacaacaacaacaa

Exon 30 +     159375     159422   0   Terminal     48    88        Good
aaagaagaagaagaaagaaagcaactaactaaaacctttcctttcaaggatttatgcagc
ataggatagggcaaccacaagtaaacacaaacatcacgtgagccttcttaaagaaaacat
ttccagaaatcactccaatgtcttaaaaaacacacaaaataaaacctttctccactgcag
TTTAACTGTGGCAATGAGTTGCAGACGATCACCAACACTGAAACTTAA
tttagcttttttctctcctctccaatcataaaaagtctctttttggttcttcatgcagga
gctattttctttcttttctggcctctaacaggaaaacagagtttctagccgagctgctcc
tgaggtattaaaagtgatgttcgtgtcatgcggatcaatcctgcccaaacattagtgtgc

Exon 31 +     162699     162787   0    Initial     89   100   Excellent
ctgagtggtttctttctgagttttctgccttcctaacaattttgggtcttacttgatgat
accaaccaaaacctaataagatttttcttgttctgtttcttcctgatatgtactgttggt
tagatcaaagatgaaaagattaaaaaggacaaagaacccaaagaagaagttaagagcttc
ATGGATCGAAAGAAGGGATTTACAGAAGTTAAGTCGCAGAATGGAGAATTCATGACCCAC
AAACTTAAACATACTGAGAATACTTTCAG
gtaagaagtagcaactagttaatagaaactgtgttcacatgcaaagaaaaaaaaaaaaaa
gtcagtcttcccatcctgtgcttccagacagaaacgtgctaagcaggcagcatgcttttg
ttgtgaggtcattagccattgtcttagagatactcagtcagcaggtccagttcttatatc

Exon 32 +     169079     169319   2   Internal    241   100   Excellent
tgattccgggcagaccccttccccagcctaccccctgggctaatgagaggcagtgggtat
ttagtcggggatgcagaagccgcagaccgacctccccttcctccagggagactacaggca
aaagcatgtaaacccctttccattgccccccaaccacagccgccctggagggagggccag
CGTGGACACCAAGGAGGCTGAGGGCGCCCCCCAGGTGGAAGCCGGCAAAAGGCTGGAGGA
GCTTCGTCGTCGTCGCGGGGAGACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCA
GCAGGAGGCGGCTTTGGAGCTGGAGGAACTCAAGAAAAAGAGGGAGGAGAGAAGGAAGGT
CCTGGAGGAGGAAGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAACTCAGAGAGGA
G
gtaaggcgggcgctagcccactgagaacgttgcccgggaaaattccctagtgccgtgcgg
ctgttcttttgagcatgggctctcaaaaatatttttttaagaataataaacttaccatgt
gctaggtactgttttataacttgtagatgtattaatttgtccactgcttctaagaactcg

Exon 33 +     171269     171340   0   Terminal     72    69    Marginal
aaccatctaaaattatatattcacttgaagcggggagcaaccataaaatcacctcttgta
ccatctggcaaatatagtaccacagatttagatagcttttcacataagttattcatttgt
cttcacaactctcctaggatgtaggtagaaggaatattcatatcccttttacatatacag
AAGTGTGAGGTCATTGTTAATGACCCACAGGATGGTGGTGATTATGTATCATCCTATGGG
AAATCATCATAA
tgagtgttagtctaagccaggggtgtccaatcttttggcttccctgggtcacattggaag
aagaattgccttgggccacacataaaatacactaacactaatgatcgctgatgagccaaa
aaaaaaaaaatcacaaaaaggtctcataatgttttaagaaagtttacgaatttgtgttag

Exon 34 +     171923     172093   0   Terminal    171    97   Excellent
aaatgcaggcagctcgactccagctctcaggctaaacctctggtgaccacctagaagggg
agtgtccagcctgcggcctgagtctgctgcctctccaactgtgctctctctcctacagca
ctcttccctttggctgtgaagctggtactgatgcctcgttatttgttctttctctcttag
GAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGAGCAGAAGCTGCTGAGAAA
CGCCAGAAGATGCCAGAAGATGGCTTGTCAGATGACAAGAAACCATTCAAGTGTTTCACT
CCTAAAGGTTCATCTCTCAAGGTATTTTTTTCCCCAGAAAACTTCTATTAG
aatatgatagagactggattttagccccttgtttagttattgattatacagggcctttgt
tcatttatctttttgctatccttccaagttaatctgttcaggctgctataacaaaatact
ttagactggggccaggcacggtggctcatgcctgtaatcccagcactttgggaggcagat

Exon 35 +     174496     174575   0    Initial     80    70        Good
ctcacttagtctttatgatggtctgggtcccagtcatatttctgatacctcccaaataaa
ttatttgtacttgaacccttgtctcaaggtctgcttcagggaaaatttaaactaagccac
agagggattatacatttaatatctgattatttatgaaatacttaatgcatgctatgtcct
ATGAGGGAAAGAACAAAGCAAGGTGGCTGCCCTGATGGCTCTAATGACTGCCTCAAAGAA
ACAATTCAAGAATTACAAAA
gtgagcagagcaaaatgagtagagaaaggccttgtggagtaggcaagctttatttataaa
ctctgaaatttgaattttatgtaattttattgtgcttttctaatgtcatgaaatattatt
cttcttttgatttttttttaaccgtttaacagtgtgaaaaccattctcaaggccaggtgc

Exon 36 +     179755     179836   2   Internal     82   100   Excellent
tgaaatattaattgggtttattttcttttgtaattcctagatagaagagcgagcagaatt
tttgaataagtctgtgcagaaaaggtaaatatgcttgatggttcaattgagctaatcagc
tagcatatgtatgagaagattctctctcatatttttatatgtatgtgtttacttttttag
CAGTGGTGTCAAATCGACCCATCAAGCAGCAATAGTCTCCAAGATTGACAGCAGACTGGA
GCAGTATACCAGTGCAATTGAG
gtgagaattgtcctcagcgttatggtcctgctgaacagaaatagattctgactacataga
agagcataaaaacacttaggacaataatcaagtccaatagccccaggagtgttagaattt
tttttttttttttttttgagacggagtctcactctgttgcccaggctggagtgcaatggc

Exon 37 +     181468     181656   0    Initial    189    70        Good
aaaagcatatttcatttttgaaagatcctctgatctagctgtgatggtttattttgaggg
acatatgtcatcagcatacagttttacaacagaaattatcactctcatttttggtggagg
tgtttacacaatgaatttttaagatgataatgttgaggaagacaaactcactataatttt
ATGAGAACAAACTTCCCAGCACCAATCCTAAAAATAACTCACAAATTTCAGGGAACAAAA
AGCGCAAAACCTACAAAGCCGGCAGCCTCGGATCTTCCTGTTCCTGCTGAAGGTGTACGC
AACATCAAGAGTATGTGGGAGAAAGGGAATGTGTTTTCATCCCCCACTGCAGCAGGCACA
CCAAATAAG
gtgagcatctgatttttgtctcttaagtgtagaggggcatatttttttgcatgtcgattt
tgatttaggaatcacactagtaaataataaaagcagtgaagaaggtgcaatttgtacttt
gttttgcaatgaccacaaaagcaagctcagagagaatgtgtttgtgaggttgcatgaggt

Exon 38 +     186851     186931   0   Internal     81    57    Marginal
aaaaaataaaaaaatcaaacaacagctgatggtcctttcaattccatttcagatcactgg
ggtaaagtgtattaaacaacaaactgattcaaataaacaatagatgtggccatttattta
gagctggctagaaaatataaatggccacctatcgatgtttttctgcttcctttttatcag
GACTTGAGACCAGGAGACGTATCCAGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGAT
AAGGTCACTTCCCCCACTAAG
gtaatctattgggaagactagtatttcagaggtttgttttcctgatgtatggtgtagtat
aatgtcctggagtcagatgagaaatatcactgacctacagatctttgcctgcacacccat
cagtgtctaaaagaccagtacataacacagtgaaatgaaaagcgcattgcaagtttgtca

--------------------------------------------------------------------------------