--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11414 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1276   0    Initial     76    91   Excellent
tgtagattcattcttcataacctctgcccagcctagcttgtgtatcatttttttttctct
attaggggaggagcccgtcctggcactcccattggcctgtagattcacctcccctgggca
gggccccaggacccaggataatatctgtgcctcctgcccagaaccctccaagcagacaca
ATGGTAAGAATGGTGCCTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCC
CAGGAGAACCAAGATG
gtgagtggggaaagcaagggatgggtgctggagaggactggaaggaggtgaggaacagga
catgtggctgggagacaggctggatgcagctgggataccctggcatacggcaggaatggg
tgcccaaggctgtcaactccctcagctcacacacttccaggagcattcagggagcctctg

Exon  2 +       5216       5451   1   Internal    236   100   Excellent
catctcaggcatgaaagtagagcatattcacttgagtgagcctccagtggtgtgaagttg
atggcaggagaaagagctggggaagaaaaggccagtggcaggtctcccctcctagcccta
tgcagccccacagtgggacccttgcatggacctcaaccatcagaatcttttcttttgcag
GTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCG
CGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACA
GGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGG
ACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATC
gtggagtattacaacgacagtaacggtcagtgaataacagaccacaggggtggaaggtct
aacccaagaggcagcccccccagtgtgagtggcaagggatcagcaggatggaaatagtcc
caatcccaggggaagaacaggagacacagcagaaacacagacatgtccacatcccaccca

Exon  3 +       8751       9087   0   Internal    337    82        Good
gagacaaacctgaaatgccaaaccaaactgagttagcccctctctgtctgttgtatatat
tggagtaataacctatttgtcttgataaagggattgcatgcttgaattgcaaaaaccttt
atttcttttgggttgcccaatgtgcaagactaagagttattttgataaatttctcaccag
GCTGACTGTCTCTCTGTGGGGTCGGGGGAGTTTTCAGGGTCTCACGTATTGCAGGGAAGG
TTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGAT
GGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCCTGGGTCCCCTTCGACCCAGCA
GCCCAGATAACCAAGCAGAAGTGGGAGGCAGAACCAGTCTACGTGCAGCGGGCCAAGGCT
TACCTGGAGGAGGAGTGCCCTGCGACTCTGCGGAAATACCTGAAATACAGCAAAAATATC
CTGGACCGGCAAGGTACTCACTGCTTCCTGCTCCCCA
gtactgagcccagaataaaagacgatctcaggctaggagctcaggcaacatcttagtccg
gtctcatctgttcctggatgtccctcagacccccagctttcatcttttaggatttattcc
ttccctgggataatataatttgtggtccaaaaagaacatcatcaaaatttcaggcagaat

Exon  4 +       9932      10215   1   Terminal    284    82        Good
ggcaagagggaaagcgtcagccttccctgatattctggaaagtctcccggggctgggggt
gggcaggtacagagcttcgagctctgctgatcgctgacatccaggggtgggggtaggaag
agacctgggccgggagaagtccacctcaagcctgcagtgtcacactctatccctccacag
ATCCTCCCTCTGTGGTGGTCACCAGCCACCAGGCCCCAGGAGAAAAGAAGAAACTGAAGT
GCCTGGCCTACGACTTCTACCCAGGGAAAATTGATGTGCACTGGACTCGGGCCGGCGAGG
TGCAGGAGCCTGAGTTACGGGGAGATGTTCTTCACAATGGAAATGGCACTTACCAGTCCT
GGGTGGTGGTGGCAGTGCCCCCGCAGGACACAGCCCCCTACTCCTGCCACGTGCAGCACA
GCAGCCTGGCCCAGCCCCTCGTGGTGCCCTGGGAGGCCAGCTAG
gaagcaagggttggaggcaatgtgggatctcagacccagtagctgcccttcctgcctgat
gtgggagctgaaccacagaaatcacagtcaatggatccacaaggcctgaggagcagtgtg
gggggacagacaggaggtggatttggagaccgaagactgggatgcctgtcttgagtagac

--------------------------------------------------------------------------------