--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16679 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1931       2203   0    Initial    273    92   Excellent
caactcctgtgagtaccttgaagtggaactatagacccaggtgggcattctgcccagcac
tggagaggggcttgtggatgtcagcagtggggtggggatgtccctagcgagaaggcattg
cagaagatctgtttccctgcctccgctcaccgtcccttcttcctgcttctcttccttccc
ATGCTTCTTTGCCCTGCAGCCCAGCTGCTTTACCAGGAGTATAGTGATGTTGTCCTGAAT
AAGGAGATCCAGAGCCAGCAGCGGCTGGAGAGCCTGTCCGAGACACCCGGGCCTAGCTCT
CCGCGGCAGCCTCGGAAGGCCCTGGTCTCCTCCGAGTCGTACCTGCAGCGGCTCTCCATG
GCCTCCAGCGGCTCCCTCTGGCAGGAAATCCCCGTGGTGCGCAACAGCACCGTGCTGCTC
TCCATGACCCATGAAGACCAAAAGCTGCAAGAG
gtactgggcaggccacggtggggagggggctacagaaaagatgacaaggtcttgtttgct
agcatccttctctcctgctcaccactgccaccaagagtcggctgtccccaccacacaggc
gcgtgtacatgccacagctgtgggtcatgtccattctgaagaagttgaattgttttctgg

Exon  2 +       6009       6169   0   Internal    161   100   Excellent
agattaaatcctactcaaatgctcttcccctccccgcagatcaacttaggttctggtgtg
actgtgaaccataaaaggatcttgctcaccgctctatccccaaaacattacacagtggct
ggcatattccagggggtaaataaaatccttaattaatcttcctcatctccaacctcctag
GTCAAATTTGAGCTGATTGTGTCAGAGGCCTCCTACCTGCGCAGTCTAAACATAGCTGTG
GATCATTTCCAACTTTCAACTTCACTCCGGGCCACACTTTCCAACCAGGAGCACCAATGG
CTCTTCTCTCGTTTACAGGATGTGCGAGACGTCAGCGCCAC
gtgagactccccttctcctaaataccactcactcagcctcactgttgttaggctttaaat
gttccattatttttttcccctcttagaaaccctttcattttcacagttatgggaagaaat
tgggcctcagtttcttccatgattcccgatggttataggaagaagaatggcaagaagagg

Exon  3 +       6256       6354   2   Internal     99    49    Marginal
tccaactttcaacttcactccgggccacactttccaaccaggagcaccaatggctcttct
ctcgtttacaggatgtgcgagacgtcagcgccacgtgagactccccttctcctaaatacc
actcactcagcctcactgttgttaggctttaaatgttccattatttttttcccctcttag
AAACCCTTTCATTTTCACAGTTATGGGAAGAAATTGGGCCTCAGTTTCTTCCATGATTCC
CGATGGTTATAGGAAGAAGAATGGCAAGAAGAGGAGAGG
gtctgtgggtggatagatccattaatggataagtaaatgagcaatgcttcctgggttgag
gttttggattactgtggtcatgcactgcattggagatgaggtggaaaaaccatctaaaga
tcagaaaacctgaacagggtcaaaagaagaatgagaaatggaatattagaataaaagtgt

Exon  4 +       6725       6877   2   Internal    153   100   Excellent
tcaaactcaggacagttttggagcgaattctagtgcatagcaaggagcacagagcagaga
gtcaatagaagttattggctaatggagtgaagaagtcaccagctcagtgtacaccagggg
ccagtcagctgtttagctgaggtccagaagtctcatgagactcgtttaaatcctgtacag
GTTCCTTTCAGACCTGGAAGAGAACTTTGAGAACAATATCTTCTCCTTCCAAGTATGTGA
CGTAGTCCTGAACCACGCCCCAGACTTCCGCCGGGTCTACCTGCCTTATGTCACCAACCA
GACCTATCAGGAACGCACCTTCCAGAGCCTGAT
gtgagactcatcccccatttaatccccatgtaggccctgaggtgaccatgcaccagtccc
cagcccagagggctatcccaagagcacactttccccattccgccctctgtattggttacc
ccagcatcacatctgagcgccctgtacatcagctcccaccgctctttcccagcccacaga

Exon  5 +       7147       7276   2   Internal    130   100   Excellent
tttccccattccgccctctgtattggttaccccagcatcacatctgagcgccctgtacat
cagctcccaccgctctttcccagcccacagatactccactgacctcccttccccgcacct
tcactgcatcccccattgctccccatatcccccctcccctaaggctcactctccgtgcag
GAATAGCAACAGCAATTTCCGGGAGGTCTTGGAGAAGCTGGAGAGCGACCCCGTCTGCCA
GCGCCTTTCCCTCAAGTCCTTTCTGATTCTGCCCTTCCAACGCATCACCCGCCTCAAACT
GCTGCTCCAG
gtagggcagatgctaccttgatcctctccccttaactcaaagggatgccctcaggaagac
ccacaacaaaggaccaaccattcttctgccaggtgtccacatcctgtctccctgctgccc
actgcctgcttgcttggaaatatttgctgctaaaatgtggtccctgggcttctccattca

Exon  6 +       8043       8132   0   Internal     90   100   Excellent
atgttctgccaagtcatacaaagttgcctaggacttgtgcttgatactgcctgcccaatt
ccagcctgggaaaaatgactgaggctgtcataacctatttccagattgcttgcaagggac
tcaaaggtcaaagcctctaacacagtgcccttcccctttcctcactctctgcacccctag
CTGATCCGGGACTGCAATAACAATGTCCAGAGTATGCGACGGACAGAGGAGCTAATCTAC
CTGAGCCAGAAGATTGAGTTTGAGTGCAAA
gtgagtcggtcccatgcaccccatccctgcccatgaactcccttaacatgtcctgcagat
caccccctaacctggaaccaccttgctcacattatccccagcccctcccctcatttctgc
ccaccttctattctgtcctatttctgggaggcctacttgggtctccaagacatactgcta

Exon  7 +      10363      10524   2   Internal    162   100   Excellent
ccagactaggacaaatccctgaggaccctggagctaccatcttgggagcaagttaggacc
atcttatggtttttgtgggaatttgcaggctgtagatgtagggatttcgaacccaaggtt
atgagggtaggtgaagtatggaaactctagaatcaggttgaaaagatttgtattttgcag
GGGTAGCCGATTCCTGGTATTTGACCATGCTCCCTTCTCCTCCATTCGGGGGGAAAAGTG
TGAAATGAAGCTACATGGACCTCACAAAAACCTGTTCCGACTCTTTCTGCGGCAGAACAC
TCAGGGCGCCCAGGCCGAGTTCCTCTTCCGCACGGAGACTCA
gtgagatggggctgggcagaggagctgggggtgggggaagatgggcagccgagaaaagaa
gtgagaccaaggcagaaaatgtgtccagaagacagccacagcctcatttagcccattctg
gactggggaccaccatagagaaattcagactcctaaaactaatggataacttgcaggaga

Exon  8 +      13622      13715   0   Internal     94   100   Excellent
tgtctatttctttattaaccattttcaaatttcctcttttgtctgtgactttcaacagcc
caaatctgtctctatctcaagtcctcccacgccacccccctccaagtccctgtctgtgtt
ccaatcccctgcctctcctaacctctcttcacactcttctcttccaaagactccccccag
GTACAGTGCCTTCGAGCCTACAAGCCCCGAGAGAATGATGAATTGGCACTGGAGAAAGCC
GACGTGGTGATGGTGACTCAGCAGAGCAGTGACG
gtaagcgggagcatgcgtgagcagcaggccaggcactgcaggcagggcagtgctgggagt
gtgttcacttcctgcagctgccatgacaaagtaccatggactgggtggcttatggcaaca
gaaatgcattctctcacagttctggaggcaagaagtcccaaatcaaggtgtgggcagagc

Exon  9 +      14748      14905   1   Terminal    158    91   Excellent
cagctgtagacttggccacacccagggccgccatgttaggacacttggaggctgggttta
tgctggaggctccccagttcactcagcctgaggattcagaaaagtctccaggaaggtgat
ccagagaagctatcgtgagcctttcccaggtaattcttcccactcaccctgtgcccacag
GCTGGCTGGAGGGCGTGAGGCTCTCAGACGGGGAGCGAGGCTGGTTTCCTGTGCAGCAGG
TGGAGTTCATTTCCAACCCAGAGGTCCGTGCACAGAACCTGAAGGAAGCTCATCGAGTCA
AGACTGCCAAACTACAGCTGGTGGAACAGCAAGCCTAA
gtcttctctgagaggagtttcgtgagctgaagaacaagctgctcatggcaagggctggcc
ccagaaccctgcaagagaggccttctgtggatggagaactaggccttctcaaagctcaag
gacaaaatccagctaacccagtccctcggcccaggcctcctttcgtgctttgtgcttggt

--------------------------------------------------------------------------------