--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (151101 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (35 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1223       1861   0    Initial    639    79        Good
aggggacgcgctccgggcgcgcgcgcggggcagccggcgccccaactccgcccgccccgc
gccccgcgccccggcgcctcgccgcccgccgcccgcccgccccggcgccgccgcccgcgc
cccggcgccccgggccggcgaggggcgcgcccgcggccgcggccgctgcatggcgctgag
ATGGCGGGGGCGCCGCGCGGCGGAGGCGGCGGCGGAGGCGGCGCGGGCGAGCCCGGGGGC
GCCGAGCGGGCGGCCGGGACAAGCCGCCGGCGCGGGCTCCGGGCGTGCGACGAGGAGTTC
GCTTGCCCAGAGCTGGAGGCGCTGTTCCGCGGCTACACGCTGCGGCTGGAGCAGGCGGCC
ACGCTGAAGGCGCTGGCCGTTCTCAGCCTGCTGGCGGGCGCGCTGGCGCTGGCCGAGCTG
CTGGGCGCGCCGGGGCCCGCGCCCGGCCTGGCCAAGGGCTCACACCCGGTGCACTGCGTC
CTCTTCCTGGCGCTGCTCGTGGTAACCAACGTCCGGTCCCTGCAGGTGCCCCAGCTGCAG
CAGGTCGGCCAGCTGGCGCTGCTCTTCAGCCTCACCTTCGCGCTGCTCTGCTGTCCTTTC
GCGCTGGGCGGCCCCGCCCGGGGTTCCGCCGGGGCCGCTGGGGGGCCAGCGACCGCCGAA
CAAGGGGTTTGGCAGCTCCTTTTGGTCACCTTCGTGTCCTATGCCTTGCTGCCCGTGCGC
AGCCTGCTGGCCATAGGCTTTGGGCTCGTGGTGGCTGCGTCGCACTTGCTGGTCACAGCC
ACCTTGGTCCCCGCCAAGCGCCCACGTCTCTGGAGGACG
gtaagtgcagccgcgcacccctcatctggtctcggacacacttgctgggacgatgctggg
aatgcccggagtcgggcgcgctttttcctatgcggcgggtggggacactgaggctccgag
tgggggtgtgttcaaggtcactcctacgagttggggacgcagtcggggctggcaccctcc

Exon  2 +      19435      19611   0   Terminal    177   100   Excellent
ggacagggtgaggacgagctcctgcccggctgactccctgtgtccctggccctgcgctgt
gggtttggcccgggcggcgtggcttttggagagctcttgctatgctctccgggcggccta
ggccctctttgtgtgtgtgggatgtcaggctccacatgttgcctccttctctccctgcag
CTCGGTGCCAATGCCTTGCTCTTCGTCGGTGTGAACATGTATGGGGTCTTTGTGCGGATT
CTGACTGAGCGTTCACAGAGGAAGGCGTTCCTGCAGGCCCGGAGCTGCATTGAGGACCGA
CTGAGGCTGGAGGATGAGAACGAGAAGCAGGTCAGTGGCTTGGGCCAGTCAGCCTAG
aggggttggctgtggggctggggaggtggaagaagctggcttcctgagcctcagtttacc
ccgtggtgacatgggccacaattcccattggtacatgttggtatttgaggctgtggagga
gatgccctgaggttttatagttagcaaatggacaggcaggctgagtttgctgcccatggg

Exon  3 +      21861      21972   0    Initial    112    42    Marginal
ttaatgcatgttctgcagtgttctcagtgtctgacatttagataccacgttctaaaagag
ttttttcttcacgcacatgaagtattcactgagtaacatttttagcagtgtaaatatgtc
atttctttcccaagtttctgaggtattttcccaaacttgtgctcttttacatctttataa
ATGATGTCTGCTTATACTCTGCTCTCTATAGCAGCCAAGGCCAACCACTGCATCAGCAGC
AGTGGGGAGCCTGTTAGGAATGCAGATTACCAGGCCTCACCCAGCCCTGTAG
gtgggaaagcccctagggtggggcccaggggggttggggttctgatgagctgctctgcag
tccctgtctttctcccgttctccctctccttctgcctattggtttccaactttctccctc
cctgcctccctctctctctgtgaggacttgtcacctcctgtttcccctgcccctttccgt

Exon  4 +      25311      25393   0    Initial     83    43    Marginal
agagactgatcaagaagaaaaagagcagacacaaataaggagcatgagggatgagaaagg
ctgcagataaagcagggattaaaaatagataatagggaaatgctgagaataattttatgc
cagtatatttgaagagagacaaaatggccaaatttccagaaaaagtgtgagttaccaaag
ATGATCCGCAAAGAAAAAGAAAGCCTGAAAAATCCTATAATTATTAAAAAGATTGATTCA
GTAATTTACAAGCTCATCAAAAA
gtaaacagcaagcccagatggttttacagatgagttagacagaacttcaaggaaaacgcg
attgcaatttgatcagtcacagcatagaaagctcgctctctgagcctaggtcgagctggc
tggtgattatggaggacggagctcggattcccacatctcacaaaggcctgtcacgtggac

Exon  5 +      26209      26268   0    Initial     60    78        Good
agcccactgggttcttcagtctccttagctctccaggagcactacattgggcccctcagt
caccgccttctgcttggttttcgtggcttgtgcgtcacagtttgctctgtatcagctccg
ggaatcccagagtctcctccctgtcattctgtggccagtgctgcaatattgctgaggaag
ATGCCGGAGCTGGTTGTCGCCTTGGTCTGTGGGAGGCTCTGCGGCATGTCCTCGGGGGCT

gtgaggaggtttgtgggtacccagttgtttgccatatctgttttttttttttgaggcaga
gtctcattctgtcaccccagcttgagtacagtggcgctatctcaactcactgcaacctcc
gcctcccgggttcaagcagttctcctacctcagcctcccgagtagctggaattacgggca

Exon  6 +      37055      37173   0   Internal    119   100   Excellent
gaggctgtgccagccctggctagtgctcctggagggagttgcttgttcagtggcagtcca
gccctggacgtgggcctacccaggctcaggggcccggcgcccttactggggagggtgagg
tgaggaggagtggagggagggggccctgctgtctaacccgggcccttctcttctgtccag
GAGCGGCTCCTCATGAGCCTCCTGCCCCGGAACGTTGCCATGGAGATGAAGGAGGACTTC
CTGAAGCCCCCTGAGAGGATTTTCCACAAGATTTACATCCAGAGGCACGACAATGTGAG
gtagggctggtgctgacccggcacagcggggagcctgggaagctgaggtgtggagataat
ggtgaaggtggggaggtgatgacagaagtggggaagggatggatggaggtggggaaagaa
tgggggtgtggaggtaatggtgaaggtggggaagtgatgatggaagtgagaaggtgatag

Exon  7 +      37494      37571   0    Initial     78    49    Marginal
tgaaggtggggaagtgatgatggaagtgagaaggtgataggtggaggcgaggaggtgata
gtggaggtgatggtggaggtgaggaggggatagtggaggtggggaggtgatgatggaggt
gtagaggtgatagtggaggtgtgggggtgatggtggaggtggggaggtgatggtggaggt
ATGGAGGTGATAGTGGAGGTGTGGAGGCGATATTGGAGTTGTGGAGATGATGGTGGAGGT
GGGAAGGTGATGGTGGAG
gtggggaggtgataatggaagtatggaggtgattttggaggtgaggaggtgatagtggag
gtgtagaggtgatggtggaggtggggggtgatagtggaagtgtggaggtggtggtggagg
tgtggaggtgatggcaaagttggagaagtgatgatggaagtgaggaggtgatagtggagg

Exon  8 +      37782      37831   0    Initial     50    65    Marginal
gattttggaggtgaggaggtgatagtggaggtgtagaggtgatggtggaggtggggggtg
atagtggaagtgtggaggtggtggtggaggtgtggaggtgatggcaaagttggagaagtg
atgatggaagtgaggaggtgatagtggaggtgtgggggtgatggtggaggtggggaggtg
ATGGTGGATGTGATGGTGGAGGTGAGTAAACTGATGATGGAAGTGAAGAG
gtgatggaggaggtgaggtgatggtgcaggtggggagatagggggagtgtggacaaaggg
tctcagttgtgaagggaggagagggcagatgtggtcaggaggttcaggtggacatctgcc
tagcagggaaacaggtcctacgtgtagggggctcttggcttcttgggtgatgcatgttac

Exon  9 +      49310      49421   2   Internal    112   100   Excellent
agcctcagtcttctcacctgtatgatgggaaccaggaagccttcatttctggtctgcatt
gaggaataaatggggtgattgattctacagtgatttggagatgtaaacatctgtacatct
ctagggattatttcctgagtgactgggagaagggcagcctggcacccctttctcttgcag
CATCCTGTTTGCTGACATCGTGGGTTTCACGGGCTTGGCATCCCAGTGCACAGCCCAGGA
GCTGGTGAAACTCCTCAATGAGCTCTTCGGCAAGTTCGATGAATTAGCCACG
gtaagtgcagcgtttttctttgttcgaattaaattagaattgcttctggagtgacgataa
gccaggtggattccctgtatttggaccatgaactagactgattgctaagcatttcttcca
gcaaggttataaatcacctgttgtttttagcctcactgttcattgattcctttccttgaa

Exon 10 +      62109      62141   0   Terminal     33    53    Marginal
taagttttgtcttctctttgatcattttggctacaagtttatcaatttcattgagttttt
aaaaaataactgcttttcatttgattgatttctctattttttctatttagtttcttttcg
tatctgtattattgtttttcttctggttattttgggtttaatttgttcttctttttgtag
TTTCTTAAGGTGGATGCCAAAGCCATTAATTAA
acattttttatgtcttttaatataagaatttattgttgtaaacttacctgaaagtattac
tttagcagtatcccacagtttctggtatgttgtgtgtttttctaattctgttcaaaatac
tttctaatttctcttgtttttttttttttttttttttttttttccaaaccccggggtttt

Exon 11 +      66897      66977   0   Terminal     81    75        Good
tctgtgctgaccccaaacatggacacatcagtagacattctgatccatggggacccaaca
cagaggagtagttgagcaatgatttaatgagtgtttaagttaggatcgcttgcattcata
taatttgctttaagggaatataagacaagtgttgtgccgggtttaagaatcctcctacag
GCTGACACAGTACTGGGCCTCCTGGTCATAGATGACAAGGCGAACATTCATGGCTTTATG
GTGCAGTTGTTACTCAACTGA
acctagctttgattgcccagcacagtaaagccaaaatatctacatggagggagaaatatc
tacagcaggagaaagaagggccttcatttgcagggtgccaagcaaggagaattgagcagc
tcccgcttaagacagaacctctccaatggcttgcaagcaaggtttttaaaggcaggggta

Exon 12 +      75397      75607   1   Internal    211    83        Good
ggagggatggacccccgaaggggaaagaggccatgagcgaggtatggggaaagggagaag
gagatcaatgtgagcctggtcccagccctcaagactgtgctgaccacgcaagggtgtggc
ctgggcgggaaggtggtggcccaggtgcagcatgtcttgccagcgctctgtggccaccag
TGTCTAGAGGTGGTGGAGCCAGCAGTGGCGCTCACAGCCTCTGTAGCGCTGTCTCTTACC
ATGTGCCTTGCCCTTCCCTGAAGGAGAACCACTGTCGCCGCATCAAGATTCTCGGGGACT
GCTACTACTGCGTGTCGGGCCTCACCCAGCCCAAGACTGACCATGCCCACTGCTGTGTGG
AGATGGGACTCGACATGATTGATACCATCAC
gtaagtaccccgtggggctgagaggagtggcctggggcatctacacattgaaatcctaga
agctgagccaccttctgccccatgtgggctcccctctcagggtctcgctttgtcctgatg
ggtctgtctgaggctgcagagaatgatgccagcattaggaggatgctgggttcaggaaag

Exon 13 +      84537      84695   2   Internal    159   100   Excellent
aggtgggcaggaaggctccatgtccactgactatgccaggagacctccacgctcaggcca
catgcagcaaggacaagacccagtttccctggtgctcacagcctagcagtgcagaccaag
gtggccccctgggaggatacaaggtgggcgccagccccacgctctgtgtctgtgttgcag
ATCTGTGGCTGAAGCCACCGAGGTGGATCTGAACATGCGTGTGGGTCTGCACACGGGCAG
GGTCCTCTGTGGTGTCCTGGGCTTGCGCAAGTGGCAGTACGACGTGTGGTCCAATGATGT
GACCTTGGCCAATGTCATGGAAGCCGCTGGCCTGCCAGG
gtaagtcggggatggggtggggaggggagggaggtgggtgatggctgtgcacccctgggc
taaatccttgcttcaggttctgggctgtgctcttgagggcacttgtgtgagtgctcctgg
aggacctgcctgtcccagccgcacctgccaaccagactccctgtggtgggcgtcccaccc

Exon 14 +      86851      86992   2   Internal    142    82        Good
atctgcctgggccctccctcctggcatggacggacttgcatgggagcatgaatactcccc
gtggagcctgccctggtgtggggaagcctctgtctgtgccccttcccctctggtaaggcc
ctgcagactctgacagcagtggttccccactcatctggcctctgcctcctccttttgtag
GAAGGTTCATATCACAAAGACGACCCTAGCGTGCTTGAATGGGGACTACGAGGTAGAACC
GGGTTACGGACATGAGAGGAACAGTTTCTTGAAAACTCATAACATCGAAACCTTTTTTAT
TGTGCCATCCCATCGCCGAAAG
gtaggcaccagagcccccctcatttggttgatccttagcttcttggcctgtgcagagctt
tacagatgtgactcctcctgcttcctctccaagcactgcttctctgggctgtgaacttgc
taagatggggagagttgtccccactgacaccgtcctgagccttgtctcttactggtgtgg

Exon 15 +      88868      89023   0   Internal    156   100   Excellent
tggttttgtttgctgctctattctgggcacgttccccaatgcctggcttgaagtaggcgc
tgagcaaatgaatcccagtgccctggggtggctgtgtttgtcaggatggcattcccagtc
cgagaggcacaatgtgtctcattcacagcatttctccttgccccttgtgtgtttggacag
ATATTTCCAGGCCTGATTCTCTCAGATATAAAACCGGCCAAAAGGATGAAGTTCAAGACT
GTCTGCTACCTGCTGGTGCAGCTCATGCACTGCCGGAAAATGTTCAAGGCCGAGATCCCC
TTCTCCAATGTCATGACCTGCGAGGACGATGACAAG
gtaggagcagccagggagcctgccatgctggagctgccagggactgatctctgtcctgcc
ctcccaatatggcccccgtgccatttggctagatcagaattccctgttcacatgtggata
atcttgtaaatgctgctcagagctgagctactttttatttcctgcaaaagtcattatagt

Exon 16 +      92040      92189   0    Initial    150    75        Good
ttagtttgctgaggatgatggtttccagcttcatccatgtccctgcaaaggacatgaact
cattcttttttatggctgcaaaaatatgatttttaaaaatcattatatagatttgcagcc
taagaaaccatttacttaatcaacctccattgatatttaggttatttctgttatatttaa
ATGAAGCAAATCGTGGACAGAGCTTTTGGTCATGAAAATACGTTTACTTCTCTGATGGTT
TTGTGTAATGGAATCCAGAGAGTCAAGTGTCTGCCTGAGTGTGTGCAGCCTGTTAGGGTA
GTTACGCTCATCGCCCACTGGGCCCACCAG
gtggggaacatgacattgcctgcctgagtcaccgtgggacacgtctctattccagtttcc
taatacctggcagcacagttgtctcctctaataggtacacccagaagcctcccaattcag
tctctctctctttttattgagcgcttcttttgttcttctcttcacacttaaatatttaag

Exon 17 +      95279      95386   2   Internal    108    80        Good
tgagatacatcccatcaatacctaatttattgagagtttttagcatgaagtgctgttgaa
ttttgtcaaaggccttttctgcatctattgagataatcatgcagtttttgtcgttggttc
tgtttatatgctggattacgtttattgatttgtgtatgttgaaccagccttgcatcccag
GGATGAAGCCCACTTGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCGGTTTG
CCAGTATTTTATTGAGGATTTTTGCTTCAATGTTTATCAGGGATATTG
gtctaaaattctcttttttttgttgtgtctttgccaggctttggtatcaggatgatgctg
gcctcataaaatgagttagggaggattctctctttttctattgattggaatactttcaga
aggaatggtagcagctcctccttgtacctctggtagaattcggttgtgaatccgtctagt

Exon 18 +      96996      97142   2   Internal    147    98   Excellent
atttcaagaaagtgatccatttgagttagcttttgaattttttcttttaataagcagatg
ttgaattttagaaaatactcttgagtaggtattaagatgcttagcctggtggttccccct
ctgactgttaatatggtcagtgatatcactgcatcctccagggttcttttgacattgtag
GAGCTTCACCTTCCTGTCCATCCCTGTGGCCTTGGGCTGTTCCTGGTACATTTTCAGAGA
TGTGTGTATCATCTACTCACTGAAGGACAGCTACCTTCCTCTCAATGTGTTGGCCACTCT
CGTGGATGCCCGTCACAGCCCAGGACT
gtgatttatgactgtggaggacagtcagtaacccaggacacagcaggtgagctgacaggc
agaggatgctgggtggtgacagggtttggaggtgtggctgacctgagggtggaccaatgt
ctattactcctgacttgagggaggatccatgtccattagcaccaaccggaaaatggacct

Exon 19 +     104656     104850   0   Internal    195    88        Good
gctgctgagatgactcacctgccatctcaccaccagcagggcagagtcatgattattaaa
tgtcagattcccaaacccgaccccaccctgcagcggatctggctggagggagagtacagg
tgcttttcttcaataagtggagaatttgatgatactcctttatttccatgatggctccag
CGGAGGGCATTAAGAACAGCCTCGGAAAAACTCAGAAACCGCTCATCTTTTTCTACCAAC
GTTGTCTACACCACCCCGGGCACTCGCGTCAACAGGTACATCAGCCGCCTCTTAGAAGCC
CGCCAGACAGAGCTGGAGATGGCAGACCTGAACTTCTTTACCCTGAAGTACAAACATGTC
GAACGGGAGCAAAAG
gtaagcaactctggttttcggcttccctggtgctgcttgcgaaggcgctgcctggctgga
ggaagccctcagccctgatggattgacttctctcttacacagtaccaccagcttcaggac
gagtatttcaccagcgccgttgtcctcaccctcatcctggctgccttatttggccttgtc

Exon 20 +     106499     106583   2   Internal     85   100   Excellent
aaaaatagaaccagccatgtcagttcccagagacctgagtggcaggcatccaggttaacg
atgctgcttcctcctgagagcacaggggatgtggagggaggggccaattctcagccatct
cttgggtccgcctctcctaatccccacctatcagtgactctcatgttttctgtcccccag
GAGTGTGGTCGTCCTGCTCCTGCTAGTATTCTGCATCTGCTTCCTGGTGGCCTGTGTCCT
GTACCTGCACATCACCCGGGTCCAG
gtatgtgggtggcctgtgtcctgtacctgcatatcacctggttcatgtatgtgagtggcc
tgtatcctgcacctgcatatcacctggtccaggtatgagggtggcctgtgtcctatacct
gcatatcaccttgttcaggtatgtgggtggcctgtgtcctgtacctgcatatcacctggt

Exon 21 +     106724     106767   0    Initial     44    58    Marginal
ggtggcctgtgtcctgtacctgcacatcacccgggtccaggtatgtgggtggcctgtgtc
ctgtacctgcatatcacctggttcatgtatgtgagtggcctgtatcctgcacctgcatat
cacctggtccaggtatgagggtggcctgtgtcctatacctgcatatcaccttgttcaggt
ATGTGGGTGGCCTGTGTCCTGTACCTGCATATCACCTGGTCCAG
gtatgagggtggcctctgcctgccctctgggtgggatggggtgggataggggaggcagtt
ctgttccctcccctgcctagacaggaagaaagagtctgctcatatagcaggtgctcatga
agacccagttctgcactgggcacatgcactcctttgggagtgtacctggtgggcacaata

Exon 22 +     112935     113005   0    Initial     71    81        Good
ggctgcctgccttgggcctggagctccaagcccaacagttccctggtggtcctttcgtct
gggggccagcgcacagccctgcccaccctgccctgcgagtctacacaccatgccctgctc
tgctgcctggtgggcaccctcccgctagccatatttttccgggtgtcctccttgccaaaa
ATGATCCTGCTCTCCGGGCTCACCACGTCCTACATCCTCGTTCTGGAGCTCAGCGGATAC
ACCAGGACTGG
gtaagtgtgtggctcctcaagaaaaaggcctaagcagcggtgctactgaatctgtgtata
cagatatgcactacaggcttctgagtccagaactagtcaagttgaattgtatacacaatt
tttagtttggtggctgcttctcttcaacccaagttctagcaaggtactcagaatttccct

Exon 23 +     113339     113494   2   Internal    156    89        Good
ttctagcaaggtactcagaatttccctatgataagtgattcttggccaaggtcaatccca
gcaagctgtttttgggtgtcaccacctgagggtcactctgaacagttcttgggtttggtg
gcagagtcttgccctggaagctcggcactgacttggcttttcttcctcatcttcccccag
GGGTGGTGCCGTCTCCGGGCGCAGCTACGAGCCGATTGTGGCCATCCTGCTCTTCTCCTG
TGCGCTGGCCCTGCATGCCAGGCAGGTGGACATCAGGCTGAGGCTGGACTACCTCTGGGC
CGCACAGGCAAGACGAGCCCTTTCTGCTTTCTGGGG
gtgggggatttagaggaggaagaagtcttcagcaagcatctgacgggggctgccacagac
acccacacgccgtatggccctcggagggccctcctcagcagcatgcaagccaggcactgt
ccggggatggaggagacctatgctgggggtccagggagtgggagccatgcctcgtgagag

Exon 24 +     119967     120147   2   Terminal    181    85        Good
tttatgtacctaaaacagatcatcaaaatacataaagtaaaaattgatagaactgcaaga
aattcttctatctataattatagttggagtttccaacattcctttcgaaaagcgatagaa
tcgctggacagaaaatcagtgacagattataacacttaagaacactgtcttgcatcccag
GGATGAAGCCCACTTGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCGGTTTG
CCAGTATTTTATTGAGGATTTTTGCATCAATGTTCATCAAGGATATTGGTCTAAAATTCT
CTTTTTTGGTTGTGTCTCTGCCCGGCTTTGGTATCAGAATGATGCTGGCCTCATAAAATG
A
gttagggaggattccctctttttctattgattggaatagtttcagaaggaatggtaccag
ctcctccttgtacctctggtagaattcggctgtgaatccatctggtcctggactcttttt
ggttggtaaactattgattattgccacaatttcagagcctgttattggtctattcagaga

Exon 25 +     122200     122288   0    Initial     89    45    Marginal
ggtctgcttgttgcttgtaggagggcaaattgaattcctgttactccatcttttccagaa
gtggaacttcatgtggccatttaagtgtctttgaccccaaaactggtcattatccccatg
taacaggtgagggccaaagtaaatggccaaaggtcagaactgaaatctgccaaaccctaa
ATGGGCACTCTCATGGATGCCATGCATGACATGTCTCAGAATCCTTCTCCTGCCAAGTTA
AGTACCATCCAGAGTGGAATGGCATTCTG
gtgagaactgtctctaggcagaatcctgtgaacacagccaagaattagaagtcctcagct
ctgaggcctgtgcttctccctccacagcagtcaagatttcatatgcatgtgtggctggag
ggtttctctgaaaggttagatctgggttagaaggacgcagcataacttcaacatagagca

Exon 26 +     128462     128507   2   Terminal     46    53    Marginal
taacattaacaatggtattttggagagagcagtaatttttgtgccactaataaataaaac
aaagctattattttagaaaatattcttcactttctgtttatgtcaccctttacaaacctt
tcttttgtgtatattggagcctgatgtgttaacacataattaataatgtgggtcctatag
AGAGGTGTTTGTCCAGAATGTCATTATTGATGAGAACTTGAGTTGA
aagcagccccggagaccatctgaggctggaaattgaaggtttctgacctttgagcatgac
ccagagtaagtcagcactgtgcccagacagccgctgcgtgggcagagtgtggctccagcc
catctgggcagccagaccccagctctggtctgaccgagaaggttatggtccctgggtttc

Exon 27 +     130152     130280   0    Initial    129   100   Excellent
gacatctgcagatcttccctacccagtaacatggatctagtcttgcatctagtggggagg
agggacaggagcgtggatgtagaccatcagcacacctggagtccagtttggatgattaga
aggaagtgtgcggtgggaacaagtgaaggcagcgtgagtggatgggactaatggaggctc
ATGATACCCCAGGCAGAGGAGGAGCGAGAGGACATGGAGAAGGTGAAGCTGGACAACAGG
CGCATCCTCTTCAACCTCCTGCCGGCCCACGTCGCCCAGCACTTCCTCATGTCCAACCCT
CGGAACATG
gtgagcacccagcctgctcctggccagcactagcccgacactgctctggccaccccactt
ggcgctcacctggctgacccttcctgacccatcctttgaacttccaggacctctactacc
agtcctactcccaggtgggcgtcatgtttgcctccatccccaacttcaatgacttctaca

Exon 28 +     130388     130574   0   Internal    187   100   Excellent
caggcgcatcctcttcaacctcctgccggcccacgtcgcccagcacttcctcatgtccaa
ccctcggaacatggtgagcacccagcctgctcctggccagcactagcccgacactgctct
ggccaccccacttggcgctcacctggctgacccttcctgacccatcctttgaacttccag
GACCTCTACTACCAGTCCTACTCCCAGGTGGGCGTCATGTTTGCCTCCATCCCCAACTTC
AATGACTTCTACATCGAGCTGGACGGCAACAACATGGGGGTGGAGTGTCTGCGGCTTCTC
AACGAGATCATCGCCGACTTTGACGAGGTGAGGCTGTGCGTCGCCATCCTGACCCCGCCT
GGTTGTG
gtggtgcatcctgttgcatgggcagagcgtgtctcacaatatgtcacattcttcgtagct
ggaatgagagaaagcaaatcccgggaagcacaggcattctgtctcctttgggatccagac
caaccatgacaggagagaagggggtcttgactctaggttgggggaccagggccactgggt

Exon 29 +     131337     131404   1   Internal     68    92   Excellent
gtcctagaacttgtctgcccaaagcaaagaagacatgttgctttcctgaatgtgtccatc
ggctctgctgttgctcctgggggctgacggctgcagcgacttttctcaaatgttatgtca
tgtttaacagttttatgttttaaacaaagctcatggaaaaagacttttacaaggacatag
AGAAGATCAAGACCATCGGGAGCACCTACATGGCCGCTGTGGGGCTAGCGCCCACCTCGG
GGACCAAG
gtgagtgcagcctggcgctgcctgcttggggactgggtccaagctctgccctaaactgct
ctgggaccctgggtagcttccacactggggtttgtttgccctctgtgttggattacagga
gcagcttgagtgctgtttttgtccgtggctggctctctccagacacaatctcctagggaa

Exon 30 +     135139     135249   0   Internal    111   100   Excellent
gccaataccctgcctctctcttagtctcctacctgtagaatggaatgataaatgtgccta
tagccaggcactcagagtgccttcctctgaaagtgcagctgttgggcactgcaggttggt
ccctggccccctcttgccttgcactccccagatgtaatgaccccatctgtttacacctag
GCTAAGAAGTCCATCTCCTCCCACCTGAGCACGCTGGCGGACTTTGCCATTGAGATGTTT
GACGTTCTGGATGAAATCAACTACCAGTCTTACAACGACTTTGTCCTCCGA
gttggtatgtggctctaaacctatcctgtccatccatgtggaacaccttcctacacccac
ctaggggtgggatcagctgatgaggtaccctggtcttacaggaaggagggtggtgccacc
caggagggcatggggacctgtgtaccgagttgcccctggaagctgctggtggaaggtgaa

Exon 31 +     137230     137264   0   Internal     35    98   Excellent
tgaacagccagtgctgttccccagtgcagtggacagtgtcgtgaggagaccctgcccagg
ggagcccgtgcagcagggcagctgcctctctggtgctgtgtgtgatgcttcaggaaggag
cctggtgctaggtgaccccaggaaacaaagccctgaaaggagcagccttttctccaccag
GAGCAGCATCAGGTGCATTTGGTGGCCCTGGTGGG
gtgagttacacttttcccgctgatgacaggtcatgcgctggctgttttctaggcatcaat
gttggccctgtggtggctggagtgattggcgctcgcaggccccagtacgacatctgggga
aacacagtcaacgtggccagtcggatggatagcacaggggtccagggcagaatccaggtc

Exon 32 +     137317     137441   1   Internal    125    94   Excellent
ctctggtgctgtgtgtgatgcttcaggaaggagcctggtgctaggtgaccccaggaaaca
aagccctgaaaggagcagccttttctccaccaggagcagcatcaggtgcatttggtggcc
ctggtggggtgagttacacttttcccgctgatgacaggtcatgcgctggctgttttctag
GCATCAATGTTGGCCCTGTGGTGGCTGGAGTGATTGGCGCTCGCAGGCCCCAGTACGACA
TCTGGGGAAACACAGTCAACGTGGCCAGTCGGATGGATAGCACAGGGGTCCAGGGCAGAA
TCCAG
gtcagttcaccaagaaacccctaaggcatgggtgcccattcttcaggtgaggaaactgag
gcacagggggccagaattgaatccccagtctacagcccgtaagtggcagggcagaaagag
ctgcatatttcggtctgtctgctctggagggcatcctggcccgggcatcttgattttgct

Exon 33 +     141733     141835   0    Initial    103    41    Marginal
gtgcattctccacccctccgccaatggcttccagctcctaaaacacctggacattcccca
tcctgcaccggcactgtgtttgttcagagaaaacgaagggtgtcatttcttcttttccct
gtggcatcgtggatcctttacatttagcaacaacagtgtgaggctccacttctgttgaat
ATGAGCGGCTGTCACACCCATGAGCAAGTTTCCTTGATGGAAGATGCTGTTTCTCCGGCA
GAACCAACCCTCCAGGACGAAGTTTCAGAATTGGCTGATGGTC
gtgagtgcaggtgtccctgttgtaatttgcagggaaattgactgcaggtgatagtgttga
cgtctgacgtctgacaacctcctatgtgcatgtctaaatagtcacaatgaagatgaaaat
aaggatgatggggacggggtccaggagggccactgggaaggcactatccagaaatagtgg

Exon 34 +     144952     145042   0    Initial     91    45    Marginal
gggaggcggggagctgccactcccaaagcctccaccccttcctgaagacccagctatgaa
accgcagttcctgtgggttgggctgcccaggctggtcagagctcagcaccccaggtctgg
tgagcagacagagccggcgttaaaccccgatcaggtcattgtcaccacacccttgcttgg
ATGAGGAAGGAAGGAGGCAAAGGCACCCACTCCATCCAAGATCCATTCCAATTGATGAGC
CTCAGTACTGGCCTCACACTGACCAACGGTG
gtatgctgcagtttgttggtttggtgcagagtctaaaggataacatatcaaggcttacct
gtgataggccattttaaggaaatggtggcactctgaaggctgtccccattcaccttccac
aatgctggtaccatcctggtagaagagccctctgaacaggacacctgttcaggcctgggg

Exon 35 +     150695     150941   0    Initial    247    40        Poor
gacagtattgcttttttggtctctcagaagttactgtagctcaggatgcaatgataagtt
cattttacattcatctgtaaatactttatttcatttcctgtcttaaaagatgaaactgat
tacacgatcagttgataatttttttttaagtttgataatatcccattcaagtttagttga
ATGGTGAAGATGGCTTCCATTGTTGTCATTGAAGAATCTTCTGTCTATCGAGTTGTTTTT
CCTTTGTGTGTTTTCCTGGGGTTCTTCAAAGAAACAGAACCAAGAGGGCATGTGTGTGCT
GTCAGAAAGAGAGAGGGGGCAAAAACAGGACAGAGAATTTATTTTAAGGAATTGGCTTAC
ATGATTGTGGGGCTGGCAAGTCTGAAGTCTATAGGAAAGGCCAGCAGGCTAGAGCCGCAG
GGAGGAG
gtaatgttgctacttgagttggaaggctgtctggaggcagaattccttcttcgtttggga
tctcagtcttttttcaaaggccttcaactaattggataaggcccatccacattgtgacgg
gctatctgccttactcaaagtctactgatgacaaatgttct
--------------------------------------------------------------------------------