Gene TPD52L1 Variant 1
DNA : 109.72 KbNT_025741
mRNA : 1325 bp NM_003287
CDS : 615 bp NP_003278
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  199 bp
gcaatactcgctttattgcgggggtctggaacctaacctgcaatatctctgcgttatgcc
cttatagcgccgggagtgggtgccttccgccggctgtacagagcgccggcaggtggcgcc
cagcggcgagcttgttccagcttggtttgggccaggtggactggaaggggcggaggtaac
CAGAAGCGGCTAGTGGCGGCTGCCTGCGTCCCCAACCCCCTCCGCGCAGCGCTCGCGACA
CGCGTGCCAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCGTTCTGAGCCTGGGCGCAGCT
GCCATCTGCTCTGGGAAGCACCAGGGTGTCCCCGCCGCCCTCAGCTCGAAGTCAGCCACC
ATGGAGGCGCAGGCACAAG
gtgagtggtcgccgatcgccccgagagtcaggtcctggggcgcgcataaaggctcttttc
ctgcaccacctaacttcgctctcggacagaacagattggtgccgtgttgcacatccagaa
ctccactcccacccgcgcctttggtataatgcctgctgcccaaactcaggatttgctgtg
EXON 2  116 bp
tattctttgctttcttggagctcgtcacacatttaggaggatttttgtcttttctggaat
ttttagttgttttttggtgggagggtctgtcagtgcatctagtcctccacactatggaag
cagaagttggtttaaattcactttaaaaattgccttctgttttatcaattctgcctaaag
GTTTGTTGGAGACTGAACCGTTGCAAGGAACAGACGAAGATGCAGTAGCCAGTGCTGACT
TCTCTAGCATGCTCTCTGAGGAGGAAAAGGAAGAGTTAAAAGCAGAGTTAGTTCAG
gtatgtttagtaatcttattgttgctatttctatctctggatcttaagagttattattag
tttgatataataattgtaatgatgttgtattgtaatgatgttgtctttcatttaataaaa
tttataaatgaatacattacaagatgattcatttttccagggtatttttctactgttaca
EXON 3  149 bp
aattctgtttctactttgagatattagactatcatctgtatggggtgtatttggcaaacc
tacacatgggattgtataaataggagggtcagaggctgctttggaatacccagagcttct
gtaagtatccttttttgctggtctgacattttcccccaccatttcccctccgccttgtag
CTAGAAGACGAAATTACAACACTACGACAAGTTTTGTCAGCGAAAGAAAGGCATCTAGTT
GAGATAAAACAAAAACTCGGCATGAACCTGATGAATGAATTAAAACAGAACTTCAGCAAA
AGCTGGCATGACATGCAGACTACCACTGC
gtaagtatcatatgaacagtgttttattaactcagcctgatgtctcctcactctgttgtg
ttttgtttcatttttcctacaaggctgatttggtgcatgaagctaggaaaaaaaaatact
ttctctaaaagcaaagcaaagaaatgtgaataatcattaagtatgctgcatgtgaagcag
EXON 4  102 bp
cttctgatgaacagcagccaacccatcatccccagacaatgaatggaaacagtggttttg
tggatcttcttcctaaatctgttgaggaaaggacattttcaaagtaaggagtgagaagga
agatgaattgtttatgggagatcatgatataaaaaccatgttgttctgttttatttctag
CTACAAGAAAACACATGAAACCCTGAGTCACGCAGGGCAAAAGGCAACTGCAGCTTTCAG
CAACGTTGGAACGGCCATCAGCAAGAAGTTCGGAGACATGAG
gtactgtgggaaaataccatgggaacggcgctaagcccttggctttccgattgaagggag
cactagctattagctgctcatctcaacatatgtatttttttattttaatggataaaaatg
ttatatggctgatatgattgatgactaagataaattttcacactgggacattttctgcct
EXON 5  39 bp
gaaagctgactatacccattatacccaacaaaaacaaatgtcatcttggttagatgggca
gggaatatttcagatatttggaattgctgttttagaactacgaatagggagtttttcatg
tacttatgtgtgctctcttcttttttcttttttcccctttaatctgcttttgctctgaag
TTACTCCATTCGCCATTCCATAAGTATGCCTGCTATGAG
gtaatgtgtgtaaaatattttatgtaatattaatatgaaatgtgtttaaggtgttatttt
atttatatttacttatggggttcctctgctttatgtgaaaggaaattgctgatggtcttc
aaaagaaaaggctgacaattctgtggaagaattgcgtagcttgggcttttgaccagacat
EXON 6  61 bp
tttctgaacctaacctaacagaagtgacatacattttaaaacgtggttggtgcaggtggc
aagctgacaggtagctctgtggcagaggccgtgtttacagatatgagcagaaaaccaaac
agcatggttgctaagacagctaggcctttggagctgacctctctctttttgttattttag
GAATTCTCCTACTTTCAAATCATTTGAGGAGAGGGTTGAGACAACTGTCACAAGCCTCAA
G
gtacagatgaagtgaattctgtgtgagtgggtccattgactcaggacagcttagccattg
ctgcggttagtttaaagtcgaggcagggccaagaaggcaggcttgcatcaagtcagacct
tttctttcacatataaatctatgaataaaaccactattgaatagtgttactatatcctta
EXON 7  659 bp
caagtatgaataatattctagcactctactaaaggaaacaaacttctgtgcattcttttg
tctctaaagatagaaagtatttctgaatttgaaagtaatccagcttttggtattcttata
aaaacattacaaaaatgatagtaacaactaactgcatttttgtggatctgctcatttcag
ACGAAAGTAGGCGGTACGAACCCTAATGGAGGCAGTTTTGAGGAGGTCCTCAGCTCCACG
GCCCATGCCAGTGCCCAGAGCTTGGCAGGAGGCTCCCGGCGGACCAAGGAGGAGGAGCTG
CAGTGCTAAGTCCAGCCAGCGTGCAGCTGCATCCAGAAACCGGCCACTACCCAGCCCATC
TCTGCCTGTGCTTATCCAGATAAGAAGACCAAAATCCCGCTGGGAAAAACCCAGGCCTTG
ACATTGTTATTCAAATGGCCCCTCCAGAAAGTTTAATGATTTCCATTTGTATTTGTGTTG
ATGATGGACCACTTGACCATCACATTTCAGTATTCATAGATGACTGTCACATTTTAAAAT
GTTCCCACTTGAGCAGGTACACAACTGGTCATAATTCCTGTCTGTGTAATTCGATGTATA
TTTTTCCAAACATGTAGCTATTGTTTGCTTTGATTTTTGCTTGGCCTCCTTTATGATGTG
CATGTCCTTGAAGGCTGAATGAACAGTCCCTTTCAGTTCAGCAGATCAACAGGATGGAGC
TCTTCATGACTGTCTCCAGCAATAGGATGATTTACTATAAATTTCATCCAACTACTTGTG
ATCTCTCTCACCTACATCAATTATGTATGTTAATTTCAGCAATTAAAAGAATTGATTTT
aatgactttgaattcttaatttctttgtcttaaaagttgctagttatgattttacagatg
caattttaaatcaacttttagccaggtgcggcggctcacacctgtaatcccaactatttt
ggatgccaaggtgagaggattgcttgaggccaggagttaaagatcagcctgggcaacaca