Gene TCF19 Variant 1
DNA : 3.26 KbNT_007592
mRNA : 1083 bp NM_007109
CDS : 1080 bp NP_009040
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  238 bp
gctgcttgcactctgaatttgggctattcaggtagtgtgctcaaagttgaaaccgcatac
agcacaactcaagtttgcatcagactgggaagcgaacttaagccagcggtgcgtggccca
ggagtgggaaaggaaatggatgcctgaagtggaagaggtggtgcagagggggcaccgccc
ATGCTGCCCTGCTTCCAACTGCTGCGCATAGGGGGCGGCAGGGGCGGTGATCTCTACACC
TTCCACCCCCCCGCCGGGGCTGGCTGCACCTATCGCTTGGGCCACAGGGCCGACCTGTGT
GATGTGGCCCTGCGGCCCCAGCAGGAGCCTGGCCTCATCTCTGGGATCCACGCCGAACTG
CATGCCGAGCCCCGGGGTGATGACTGGAGGGTCAGCCTGGAAGACCACAGCAGCCAAG
gtgagcattaagcagggcagctttgcccctgggtggttgaagcgccaggctggaatgagt
aaggtctccacaagaccctgctgcctgcctcccatactcccatcagattggatggatagt
cgtggtccagaccttcatcttcccaccagaagtgtgcacagtcagaagctctctgccaga
EXON 2  563 bp
cctagctgacaaggagtgtactgcctggtacctgtcacctgctgaggggcttaggatgtg
agggagaatctgactacagtttcatattcttccccagaaatcatacagatttctccactc
ctgactctggtcatttctgtttttgtcctccatatttgcctggtgccccaccatcaacag
GTACTTTGGTCAATAATGTCCGACTCCCAAGAGGTCACAGGCTGGAATTGAGTGATGGAG
ACCTCCTGACCTTTGGCCCTGAAGGGCCCCCAGGAACCAGCCCCTCGGAGTTCTACTTCA
TGTTCCAACAAGTACGAGTCAAGCCTCAGGACTTTGCTGCCATTACCATCCCACGGTCTA
GGGGAGAAGCCCGGGTTGGGGCTGGTTTCCGGCCTATGCTGCCCTCCCAGGGGGCTCCAC
AGCGGCCTCTCAGCACCTTCTCCCCTGCCCCCAAGGCCACACTGATCCTAAACTCCATAG
GCAGCCTCAGCAAGCTCCGGCCCCAGCCCCTCACCTTCTCCCCTAGTTGGGGTGGACCAA
AGAGCCTGCCTGTTCCCGCCCCACCTGGGGAAGTGGGGACCACGCCTTCTGCTCCACCCC
AACGCAATCGGAGGAAATCTGTTCACCGAGTGTTGGCGGAACTGGATGATGAGAGTGAGC
CTCCTGAGAACCCGCCACCGGTCCTTATGGAGCCCAGGAAGAAACTCCGTGTAGACAAAG
CCCCACTGACTCCCACTGGGTAA
gtggagtcctcacttggccctctcagtgttttactgcttttcgattccttgtatccctag
gctgtgaggaggtccccctgcctggggggatgggcacgggaggtggaatagatggaatgg
caagacctgggttagctctgataggaaaagaaaaatatgtgcaggagaacatgagaggtg
EXON 3  282 bp
cacactagaggtttttaggcccaccctatgtgtttttaaggacagagtccaggctcacct
tagttctcagaccactgtgcctctgtggcctcaccctatgaccagccatagggtggcaag
gtctaggccttctcctacaggtttccggtgacccttgtgtctgtgtcacttccttcagaa
ATCGACGTGGCGTCCTCGGAAGTACCCAGTGAGCGCTCCCATGGCTCCCCCTGCAGTTGG
GGGCGGGGAGCCCTGTGCAGCTCCTTGTTGCTGCCTGCCCCAGGAAGAGACAGTGGCCTG
GGTTCAGTGTGATGGCTGTGACGTCTGGTTCCATGTGGCCTGTGTTGGCTGCAGCATCCA
GGCTGCCAGGGAGGCCGACTTCCGATGCCCAGGGTGCCGGGCTGGCATTCAGACCTAAGG
TCCACCGCCAAGGCACCATCGGACACACCTGCCCATGAGTAG
acacagcagcgagcaaataggtctgataaataccccccttcccttccctccccaagaggg
aatgactacagggaagaaggatggattgatgtggactcattcagggcctggagcagaccc
tggtggccaagacagaagagatggtttcctgccaaagatattgccacctccaggaaattg