Gene TBX18 Variant 1
DNA : 27.50 KbNT_007299
mRNA : 1944 bp XM_291165
CDS : 1944 bp XP_291165
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  292 bp
gatcccaacacaagcgagaaagcggaaacgccaaatctgttttttgcccgcggtggggaa
gggggcagatctcgggaggccccgagagccttttagtttttggtgggggaagagcgagag
cgcgcgtgtgcccgcgtgagtgtatatgagagaggggcgggcgggcgcggggcggggggg
ATGGCCGAGAAGCGAAGGGGCTCGCCGTGCAGCATGCTAAGCCTCAAGGCGCACGCTTTC
TCGGTGGAGGCGCTGATCGGCGCCGAGAAGCAGCAACAGCTTCAGAAGAAGCGGCGAAAA
CTGGGCGCCGAAGAGGCGGCGGGGGCCGTGGACGACGGAGGCTGCAGCCGCGGCGGCGGC
GCGGGCGAAAAGGGTTCTTCTGAGGGAGACGAAGGCGCTGCGCTCCCGCCGCCGGCTGGG
GCGACGTCTGGGCCGGCTCGGAGTGGCGCAGACCTGGAGCGCGGAGCCGCGG
gtgagtgggccccttcctgcctataacttctctccggcgcgaacctgaacttctgcgagt
ctgtgggtgtgcgtgcgcgccgcgtccctacatggccaaggccactcagccactagcgca
ttggccgtgtcagtcgcaaagctcgccgcgcaacctggtcaccctccagacggttcagat
EXON 2  120 bp
cagacggttcagatactgcttccaggctcgcctcgcgggcggccgccgcccactcggcga
cccgcgccttcggccgcggctgtttgctgcgcctagcggtgcagctctgtgcttcctgca
tctgcctcccttggggttccagccaatgggtgctcttttttgtttcctaacttttaaaag
CACAGGGCGGGGAGGAGGGGAGCGACGGCATACCCCACCCTGAAACCGGAACGAATGCCC
TAAACCGTTTGTGCAAACCAGGAAGAGGGCGGCATATTTGGAAACTTGGTTTCCCGAAGG

gtagttgagcggttcccttcccttctcctcttgatttctctgccaaggccgacggcgacc
gcgggcttgcttttcacacttttctctgctgggctggaagcgcagggcgccgggagtttg
gcgaaagcggggtctgaagagccttctagaagatgcctccggcccggcccaaaagaaggc
EXON 3  205 bp
acaggcagaatgtgggtgtctatcgactggcttgttctttaggaggacctgatggcacca
aagcttccccttttctcccggtcattttcctcttctcagccaccaggtgggcccgtctcc
gcggctggcttcccctctgtttccctcaccagttccctttctctgtcctttgctgtccag
GCGGCTGTGAGGACGGCTTCCAGCAGGGAGCTTCCCCTCTGGCGTCACCGGGAGGCTCCC
CCAAGGGGTCTCCGGCGCGCTCCCTGGCCCGGCCCGGGACCCCTCTGCCCTCGCCGCAGG
CCCCGCGGGTGGATCTGCAGGGAGCCGAGCTCTGGAAGCGCTTTCATGAGATAGGCACTG
AGATGATCATCACCAAGGCCGGCAG
gtaatgggcaagctggcgtggacgcccctccctaccccagaccctgtcttcactcacctc
tagctcaatcaggaagaagggcctgcagctcggtgggggttctggatagcattttcggtc
aaacgggaccaggccccagaccgtggttcactttggaggctagctttggctacccaccac
EXON 4  102 bp
aaaaatctcagttctgatatgttctatgtcctgactccttgaattacattggcaaagtga
atactataaatttatccatattaaaaatagagatccaagaggtttctttgcttattcacg
ctccatccttagtcacaaacaaaaaccccaaaccctctttctcttcgcctttttaaatag
GCGCATGTTTCCAGCAATGAGAGTGAAGATCTCTGGATTAGATCCTCACCAGCAATATTA
CATTGCCATGGATATTGTACCAGTGGACAACAAAAGATACAG
gtacagtgattagatactgaacaattaaaaaaaaaaacactaggattttgcaggctagtg
cctgtttgatctgtgaggactgtgatctttgcttccagaagtctgtagaatttccagatc
catactttaacgcccatgggtgccagcggcccagatggtgccttttcttgcggcaaatgt
EXON 5  172 bp
gtaggccactgctgcctcagagtggtttggaaaagcgcttgaaattttatttttagtgta
aagaggaaattgatttattttaaaactgaaacaaaataggcacacattttgtctgattct
actgagttggacatgccaagataaaaacagtatactgaacgcctggtcattgccttctag
GTATGTTTACCACAGTTCGAAATGGATGGTGGCAGGTAATGCTGACTCGCCTGTGCCACC
CCGTGTGTACATTCATCCAGACTCGCCTGCCTCGGGGGAGACTTGGATGAGACAAGTTAT
CAGCTTCGACAAGCTGAAGCTCACCAACAATGAACTGGATGACCAAGGCCAT
gtgagtagatggcctctctaatgcatctgtagatggcacagccacatctacactgtgcct
gactaaaggaaatgaatgcttctaagatcataatgttcattgcctgattgattagtatgt
acactgtctttgcagaatcaagtttatatttgcatagactgtgcctgttgccagaattat
EXON 6  168 bp
ttttacaaacaacttcttagccttccttctccagttctgatatttcttattaaattgaca
cctctgcatccttggaaatgatttccaatcagaattgattgtacacattaaatatttagt
caggttgttgaggttgggcagaggcttctgataaattcagcttttccttctttgatatag
ATTATTCTTCATTCTATGCACAAATACCAACCGCGAGTGCACGTCATCCGTAAAGACTGT
GGAGACGATCTTTCTCCCATCAAGCCTGTTCCATCCGGGGAGGGAGTAAAGGCATTCTCC
TTTCCAGAAACTGTCTTCACAACCGTCACTGCCTATCAGAATCAGCAG
gtattgttctcagaattggaatctttgtagatttttcatttcaggtgaagagagaaagtt
agctatccttctcactctaaatattatgaattataaagcatttgccatatatgacattca
aagtgtatatatatgaataacagttctttatccatgattttccaagtaagtctgctctaa
EXON 7  65 bp
atgatttctgaaattttccttagctttactgctaggatattaaaatacttggggaataaa
agaggcttatacaatagagtcctctaacagttaacttttgactcattgtagttttgcaac
caagtaaaaacttgcttgacatttatataagatttgatatttttttttcctactctgcag
ATTACTCGCCTGAAGATAGATAGGAATCCATTTGCTAAAGGCTTCCGAGACTCCGGGCGC
AACAG
gtgggccttagtgaagaccattccggttatgataaatatatttgatattttattatgaat
tttctattacaaagtaaatggctaaatttactaatacgatattgaaatcatttctgatga
ggactgttgtgcctcggagataacttatttttgtagtgtaatggtgtcacctaccctaag
EXON 8  95 bp
taacaggatgttagcccattgctgaagcatttcttcttgccagtggcaagatcctaactg
gacagtgtgggggtactgtcaatatcagtgttgttttgagatgcttgctgctggtgaaag
atccaaatgctcctaactagacttcttttgtccacccctatcctgaccctttccatttag
AATGGGTTTGGAAGCCTTGGTGGAATCATATGCATTCTGGCGACCATCACTACGGACTCT
GACCTTTGAAGATATCCCTGGAATTCCCAAGCAAG
gtaactcacaaagtctcctgggtcatatatacagcccgttcctgcctagaaactcaggca
ctaaaagtgtacaagtcattatttatacttacaataatgacctcatcaccagcattgtcc
tacagattccatctgtcttctgcatggtatggggatggatcaggaaaaaacggctctcat
EXON 9  725 bp
taattggaaatgagatttttcaaccagataattccttgaaagctgagaccatctcctttt
catctctgtagcattcctccaacccttgccttgtaacaagctgtgtctagctcatattta
caaaattgaaaggaaaggatgactgtggagtcattctttacatttcaacttcttttgtag
GCAATGCAAGTTCCTCCACCTTGCTCCAAGGTACTGGGAATGGCGTTCCTGCCACTCACC
CTCACCTTTTGTCTGGCTCCTCTTGCTCCTCTCCTGCCTTCCATCTGGGGCCCAACACCA
GCCAGCTGTGTAGTCTGGCCCCTGCTGACTATTCTGCCTGTGCCCGCTCAGGCCTCACCC
TCAACCGATACAGCACATCTTTGGCAGAGACCTACAACAGGCTCACCAACCAGGCTGGTG
AGACCTTTGCCCCGCCCAGGACTCCCTCCTATGTGGGCGTGAGCAGCAGCACCTCCGTGA
ACATGTCCATGGGTGGCACTGATGGGGACACCTTCAGCTGCCCACAGACCAGCTTATCCA
TGCAGATTTCGGGAATGTCCCCCCAGCTCCAGTATATCATGCCATCACCCTCCAGCAATG
CCTTCGCCACTAACCAGACCCATCAGGGTTCCTATAATACTTTTAGATTACACAGCCCCT
GTGCACTATATGGATATAACTTCTCCACATCCCCCAAACTGGCTGCCAGTCCTGAGAAAA
TTGTTTCTTCCCAAGGAAGTTTCTTGGGGTCCTCACCGAGTGGGACCATGACGGATCGGC
AGATGTTGCCCCCTGTGGAAGGAGTGCACCTGCTTAGCAGTGGGGGTCAGCAGAGTTTCT
TTGACTCTAGGACCCTAGGAAGCTTAACTCTGTCATCATCTCAAGTATCTGCACATATGG
TCTGA
tgaagcctttaagttaaatgacatttggatctgtctaacatattttctttttctttttta
aaagctatgtggaaagaaactctctgtggtttataaaatgtacatataatagaaaatgaa
ggctcactgggttttttgactttatcatggtgagattgtaattatctatggtatatatgt