Gene SLC22A2 Variant 2
DNA : 42.17 KbNT_007422
mRNA : 3676 bp NM_153191
CDS : 1484 bp NP_694861
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  584 bp
tgggccagcactcagattccctgcggtgggacacagagggcgggttgtttgtgctgctgg
cgtggagcaccgacaagcctgtggagaaccagttataataaacacgacaggcatcctggg
agtgagctcagggcatttgggaagtgcagaaggacatgcacccccgctggaggggtgcac
CTTTGAAGTCAGCTGGACCAAGGAAAGGCCCTGCCCTGAAGGCTGGTCACTTGCAGAGGT
AAACTCCCCTCTTTGACTTCTGGCCAGGGTTTGTGCTGAGCTGGCTGCAGCCGCTCTCAG
CCTCGCTCCGGGCACGTCGGGCAGCCTCGGGCCCTCCTGCCTGCAGGATCATGCCCACCA
CCGTGGACGATGTCCTGGAGCATGGAGGGGAGTTTCACTTTTTCCAGAAGCAAATGTTTT
TCCTCTTGGCTCTGCTCTCGGCTACCTTCGCGCCCATCTACGTGGGCATCGTCTTCCTGG
GCTTCACCCCTGACCACCGCTGCCGGAGCCCCGGAGTGGCCGAGCTGAGTCTGCGCTGCG
GCTGGAGTCCTGCAGAGGAACTGAACTACACGGTGCCGGGCCCAGGACCTGCGGGCGAAG
CCTCCCCAAGACAGTGTAGGCGCTACGAGGTGGACTGGAACCAGAGCACCTTCGACTGCG
TGGACCCCCTGGCCAGCCTGGACACCAACAGGAGCCGCCTGCCACTGGGCCCCTGCCGGG
ACGGCTGGGTGTACGAGACGCCTGGCTCGTCCATCGTCACCGAG
gtaagagagtgagctcagggctcagatggagaagcaaatggtggagattttctcaaggaa
gcaagcagggaaggcccggctcttataaaccctgcctggacatctctttggcctgcatgt
atcttacaaaatcctagtttccaaatgagaacatgcagcttctaatttgtctggagaata
EXON 2  104 bp
agagagagaagaagaagaaaattggcatgatcaagaaacaatggcttattgccacttaac
tatacagttcaattcaaggaatatttaatgagtaccctagctgagttatgtccaacagga
ttctaacaggatttcatttcctttctctcccaacttggaacacttctcccctgctggcag
TTTAACCTGGTATGTGCCAACTCCTGGATGTTGGACCTATTCCAGTCATCAGTGAATGTA
GGATTCTTTATTGGCTCTATGAGTATCGGCTACATAGCAGACAG
gtaggttgaatcacctgtggtggaatttaaacaatcccaaaggtttggagaacacttgga
tgcacctgcccctgcttgaatcccatcctttcccaagcacacagaccacaatctcctggc
cttcatgctggtgtttttacaatcttaaatttcttctgctgcttggataaccatgaccaa
EXON 3  163 bp
gtgctacctggacctggagtcacagattccctttgtggctatcagtctgtgcctcctgga
ttcataaaatttaaagttaacctctaactttgtttagatttccataacttccatgcattt
tccacaatcttcacaaatcaaaattaattcaattccctctctttgtttttcttcctgcag
GTTTGGCCGTAAGCTCTGCCTCCTAACTACAGTCCTCATAAATGCTGCAGCTGGAGTTCT
CATGGCCATTTCCCCAACCTATACGTGGATGTTAATTTTTCGCTTAATCCAAGGACTGGT
CAGCAAAGCAGGCTGGTTAATAGGCTACATCCTGAGTAAGAAT
gtttgtgcttgcaactgtgagaacaaagcaacctcgctgccaaaatagagtcaggtgggg
ggcggcatgcaagaaaagggacccagcttcaagacaatattgagagatttttttatttct
gtatcaaaagaattcctaaaagcatatcaactcattcagcattcctccttataaactaaa
EXON 4  160 bp
atagttataacaaaataaaaaccaaaaaacacttaaaaatattcagagagttgcgtagaa
tattctagaatttgtctatatttttgaggttggtgttctagtttcctgatagctggacag
ccaactcattattgtattgaattgcattaaccattcaaattctctctgcagttacagaat
TTGTTGGGCGGAGATATCGGAGAACAGTGGGGATTTTTTACCAAGTTGCCTATACAGTTG
GGCTCCTGGTGCTAGCTGGGGTGGCTTACGCACTTCCTCACTGGAGGTGGTTGCAGTTCA
CAGTTTCTCTGCCCAACTTCTTCTTCTTGCTCTATTACTG
gtaagtccatttggaataaaaaggaaataaatcaaagtattttattctgctaagaagtct
gccttccttaatgcacactatctttctgattctgagattgctttcactctccagacccat
ttcacaaagagcccaattccatgtttcaggaataaaaaccacaagcttcacctctccgtc
EXON 5  115 bp
tccctgaggagggatttagcatttgagggaggaaagaaccacatatccccctacacgagt
gttattttctttggagatccaactgtattaacatcctcagagaaatctgattataaaaaa
atgggggatggggtaaggaggattcagtaagagttgccctccgctcaccttgtaccctag
GTGCATACCTGAGTCTCCCAGGTGGCTGATCTCCCAGAATAAGAATGCTGAAGCCATGAG
AATCATTAAGCACATCGCAAAGAAAAATGGAAAATCTCTACCCGCCTCCCTTCAG
gtgagccagggccttaagtatcaaatcaggggatggagaaaagggaggctctggtaagat
tcatgcatgccagtgatctcagcagggaaccatggaagcacccacccccttgcattttgg
cttacctgtagcggaatgcaacagagaattttatatgctaagatttgtggttccgtggga
EXON 6  107 bp
ttcagtctcaaaaaaaaaaaaaaaaaaaaaatgaaatgggacacagtatggaaagtgctt
gctctagtgctgggcatgagatgggcgctcaggacggtaagaaattattgttattcccta
tgtgacccagggacactagcattaaatatacaaagccgtcctttctattccttttcttag
CGCCTGAGACTTGAAGAGGAAACTGGCAAGAAATTGAACCCTTCATTTCTTGACTTGGTC
AGAACTCCTCAGATAAGGAAACATACTATGATATTGATGTACAACTG
gtaaggaatatttttcactttgaaatgcctccaaattgttttaatcacagtcatccatag
taaggaagggaagaaaacatgacctcatcccggtattagcgctgacggtgggcagcaatg
tgggttgtgtctggtaggttttcctgatcgtgtttttcttgggcaaatattaagatcggt
EXON 7  1493 bp
ccagccacagccagccactgaagtagatcagagattataaaagcagtgggatgggggact
agcaaggagatggtcacagggaaaggtgacctacaatccacattatttttccagaagcct
ctcttttttggtgccctgtgtttggtgcttgacttgacctgaactctcctctttgctcag
GTTCACGAGCTCTGTGCTCTACCAGGGCCTCATCATGCACATGGGCCTTGCAGGTGACAA
TATCTACCTGGATTTCTTCTACTCTGCCCTGGTTGAATTCCCAGCTGCCTTCATGATCAT
CCTCACCATCGACCGCATCGGACGCCGTTACCCTTGGGCTGCATCAAATATGGTTGCAGG
GGCAGCCTGTCTGGCCTCAGTTTTTATACCTGGTGGTAAGTTTCAGGTGAAGTTGGAGTC
TTATCTCCAAGACCCTGGAGAAAGGGAGTGTCACGGCCCATTGATAGGAAAACCATGTAA
TTTGTCATCCAAATCAATTTGGAAAGACAAATTGGAGGGCAGTATCTGGGACCCTTCTGA
GCAAATTCATATGGCCAGCCTCCCTTTAGGAAAAATTGTACCCAATTTTTCCTTGATGTG
ATGTAACAAGAGAGACTTTACAGCCCCATGCTACAGGCCATCAAGATGACCTGGAGCAGA
GAGCATGGGCCTTGGGTAAAGCAGGCCCAGGTCAAGGTCTTACTCCAGCCCTTCCTGGGT
GTTAACTGGGGACTCTCTTGACCTCCCTGCATCAACCTGCAGAATAAATGAGAAAAATGT
AAGTAAATGCCATCCATAAATAACTATTCAGTTCCCTTTTTCCCTTTTAAAATGCTTCCT
CAACGAAGGGGAACAAATACCTGGATAAGAGAATCCTTTTAGCAATATGGAGCTTCGTTT
GAATCCTTTTGTTATTAGCAGTTGTTTAAATGTGCCCATATTTTGCTCTTTCTTTGACTT
CTATAGACTAAAGTTGGCCCAGCTTTGGAAACTGGTATAACTCCGTTGTCATTAACAACT
GAGGTCTAAAGTTAAGAGAACACAGAGGATTTTTAGGGCAGTGAAATTATTCCATATGAT
ACTAAAATAGTGGATACAGGTCATTATGCATTTGTCCAAACCCACAGGAGGTGTACCACC
AAGAGTGAACCCTAATGCCAGCTATAGATTTGGGGTGATTATCGTTGCCACTGAAGGTTC
ATCAAGTAACAAACATACCACTCTGTGGAGAATGTCGATGATGGGCAGTGGGGGGTGGAA
TGCATGTGTGGGGGCAGAGGTTATGTGGGAAATCTCTGTACCTTCCTCTCCATTTTGCTG
TGAACTTAAAACTGCTCTAAAAAAAATATCTTTTTTAAAAAAGAGAGAATTAGCATTGTG
TCTGAGGTTAAGATGAACAAACGTGAGAATCTGCTGACATTAACATGAGCCTATAGAAGA
AGTCATTTTTCTTTCTTGTCCCATTCTGGGATGGGGAATTTGTCCTTACAGTCCCACTCT
GGAGCACTGTCTGAAGATGAGGAATCATCTGTGTACGGATAAGTACTGTTCTTTTCCCTC
TTAGATCTACAATGGCTAAAAATTATTATCTCATGCTTGGGAAGAATGGGGATCACAATG
GCCTATGAGATAGTCTGCCTGGTCAATGCTGAGCTGTACCCCACATTCATTAG
gtgagtgcattttccttagaatgacgagggtgggtgagacatttgttcattggctggaac
caccacaagtgcagacaaaggatatcttaccttcaaaacacagtgtaagggaaggtgaga
acacgtaaaggtccagccaggcccagcagttcacctctcacacttacaggctggggtaaa
EXON 8  113 bp
tgtatgaataagttcttcagtggtgatttctgagattttggtgcacccgtcacctgagca
gtgtacactatagctcttgaacattttaattatttgaggaagtgtttattcaggggtgga
tgggagataactactgcactgtgataagttaacaagttaaatcagtttcctgcattctag
GAATCTTGGCGTCCACATCTGTTCCTCAATGTGTGACATTGGTGGCATCATCACGCCATT
CCTGGTCTACCGGCTCACTAACATCTGGCTTGAGCTCCCGCTGATGGTTTTCG
gtaagaaatcttcacagatgtctttaagtgaaaacttatttttctagagaccttcacttc
tcttctacttcattcaaaacaggtgtcatgcctattagtaactactaattactactcata
gtagtaatgatgtgtctgtggcttgcgttcttcctggatgtgcctagtaattagtaatat
EXON 9  100 bp
gagtttggaactggtataatatttataatggaaaatacagcagtcagagatggcaaagga
atctgtaaataagtatagaaaaatgctaaaaaaaagttttaaacaaaaataagggaaact
ctaattatagaccttgagtttttcagttcttaatgtgatattcatctgtttggctttcag
GCGTGCTTGGCTTGGTTGCTGGAGGTCTGGTGCTGTTGCTTCCAGAAACTAAAGGGAAAG
CTTTGCCTGAGACCATCGAGGAAGCCGAAAATATGCAAAG
gtaggcagttgaaagttctaaatgaattgttctataaaggttttaagacaaccctatagc
catttggaaagaattaaattgactttatacttcacaccatacactgagataaattcaaac
taaatcaaagacttgaaagcatcaaaaaaattagtaaaattacaaagacattatacgaga
EXON 10  737 bp
ttatcaacaagttctgtccattttctttgtgagaaccaccactcagaacacattgcaaga
ctaatcctgaacaaagtttataatcatttgttgttcctctcatttattacccactttatt
ttggttttcagcctcctcataatttctttctcccctctccatttttatttcttattgcag
ACCAAGAAAAAATAAAGAAAAGATGATTTACCTCCAAGTTCAGAAACTAGACATTCCATT
GAACTAAGAAGAGAGACCGTTGCTGCTGTCATGACCTAGCTTTGATGGCAGCAAGACCAA
AAGTAGAAATCCCTGCACTCATCACAAAGCCCATACAACTCAACCAAACTTACCCCTGAG
CCCTATCAACCTAGGTCTACAGCCAGTGGAGTCTATTGTACACTGTGGAAAAATACCCAT
GGGACCAGATCCTGCCAAATTCTTCCAGCTCACTTTATTCTCAGCATTCCTAGGACATTG
GACATTGGTTTTCTGGAGGGTTTTTTTTCCATCTTTGTATTTTTTTAAATTTGATTCTTT
TCTTTGCAATGCTATCTAACCAGAATACATAGGGGAACTGTGGGCTAGGCAAACAAAATA
GAAAAAAGTGTGAAAAACAGTAAAGTTGGGAGAGGAGCATCTATTTTCTTAAAGAAATAA
AACACCCAAAACAATATAAAGTTGTCCAGAATGTATGTCAAGAATTTTAGATAGGCCTTT
CAGTAACACAGGTGAAGAAATTTTTAAAAATACATTGATTATTATCTAGGTTAGACTTAA
AGTGAATCTCAAATAAAAGAATCAGGAATACAACTTAAGTGATCATGAGGTCCTTCCATA
TTTAGATTGGGTAAGCATGAATGTGTATTTTCTACAAAAGACCTTGAGAAGAGTTCAATA
AAAAATGTTAGCATTAT
aaaaccattgatgatcattttttagtctggtaaaaatgtcttaacatttgtggattttaa
aatacatgttaatattttataaaagtaatattatgaatacatttttaaaagctaaatatc
ataagacttataatgaaaacaaaatttccttgccctatttcacctctactaatttctcag