Gene SLC22A2 Variant 1
DNA : 42.17 KbNT_007422
mRNA : 2511 bp NM_003058
CDS : 1667 bp NP_003049
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  584 bp
tgggccagcactcagattccctgcggtgggacacagagggcgggttgtttgtgctgctgg
cgtggagcaccgacaagcctgtggagaaccagttataataaacacgacaggcatcctggg
agtgagctcagggcatttgggaagtgcagaaggacatgcacccccgctggaggggtgcac
CTTTGAAGTCAGCTGGACCAAGGAAAGGCCCTGCCCTGAAGGCTGGTCACTTGCAGAGGT
AAACTCCCCTCTTTGACTTCTGGCCAGGGTTTGTGCTGAGCTGGCTGCAGCCGCTCTCAG
CCTCGCTCCGGGCACGTCGGGCAGCCTCGGGCCCTCCTGCCTGCAGGATCATGCCCACCA
CCGTGGACGATGTCCTGGAGCATGGAGGGGAGTTTCACTTTTTCCAGAAGCAAATGTTTT
TCCTCTTGGCTCTGCTCTCGGCTACCTTCGCGCCCATCTACGTGGGCATCGTCTTCCTGG
GCTTCACCCCTGACCACCGCTGCCGGAGCCCCGGAGTGGCCGAGCTGAGTCTGCGCTGCG
GCTGGAGTCCTGCAGAGGAACTGAACTACACGGTGCCGGGCCCAGGACCTGCGGGCGAAG
CCTCCCCAAGACAGTGTAGGCGCTACGAGGTGGACTGGAACCAGAGCACCTTCGACTGCG
TGGACCCCCTGGCCAGCCTGGACACCAACAGGAGCCGCCTGCCACTGGGCCCCTGCCGGG
ACGGCTGGGTGTACGAGACGCCTGGCTCGTCCATCGTCACCGAG
gtaagagagtgagctcagggctcagatggagaagcaaatggtggagattttctcaaggaa
gcaagcagggaaggcccggctcttataaaccctgcctggacatctctttggcctgcatgt
atcttacaaaatcctagtttccaaatgagaacatgcagcttctaatttgtctggagaata
EXON 2  104 bp
agagagagaagaagaagaaaattggcatgatcaagaaacaatggcttattgccacttaac
tatacagttcaattcaaggaatatttaatgagtaccctagctgagttatgtccaacagga
ttctaacaggatttcatttcctttctctcccaacttggaacacttctcccctgctggcag
TTTAACCTGGTATGTGCCAACTCCTGGATGTTGGACCTATTCCAGTCATCAGTGAATGTA
GGATTCTTTATTGGCTCTATGAGTATCGGCTACATAGCAGACAG
gtaggttgaatcacctgtggtggaatttaaacaatcccaaaggtttggagaacacttgga
tgcacctgcccctgcttgaatcccatcctttcccaagcacacagaccacaatctcctggc
cttcatgctggtgtttttacaatcttaaatttcttctgctgcttggataaccatgaccaa
EXON 3  163 bp
gtgctacctggacctggagtcacagattccctttgtggctatcagtctgtgcctcctgga
ttcataaaatttaaagttaacctctaactttgtttagatttccataacttccatgcattt
tccacaatcttcacaaatcaaaattaattcaattccctctctttgtttttcttcctgcag
GTTTGGCCGTAAGCTCTGCCTCCTAACTACAGTCCTCATAAATGCTGCAGCTGGAGTTCT
CATGGCCATTTCCCCAACCTATACGTGGATGTTAATTTTTCGCTTAATCCAAGGACTGGT
CAGCAAAGCAGGCTGGTTAATAGGCTACATCCTGAGTAAGAAT
gtttgtgcttgcaactgtgagaacaaagcaacctcgctgccaaaatagagtcaggtgggg
ggcggcatgcaagaaaagggacccagcttcaagacaatattgagagatttttttatttct
gtatcaaaagaattcctaaaagcatatcaactcattcagcattcctccttataaactaaa
EXON 4  160 bp
atagttataacaaaataaaaaccaaaaaacacttaaaaatattcagagagttgcgtagaa
tattctagaatttgtctatatttttgaggttggtgttctagtttcctgatagctggacag
ccaactcattattgtattgaattgcattaaccattcaaattctctctgcagttacagaat
TTGTTGGGCGGAGATATCGGAGAACAGTGGGGATTTTTTACCAAGTTGCCTATACAGTTG
GGCTCCTGGTGCTAGCTGGGGTGGCTTACGCACTTCCTCACTGGAGGTGGTTGCAGTTCA
CAGTTTCTCTGCCCAACTTCTTCTTCTTGCTCTATTACTG
gtaagtccatttggaataaaaaggaaataaatcaaagtattttattctgctaagaagtct
gccttccttaatgcacactatctttctgattctgagattgctttcactctccagacccat
ttcacaaagagcccaattccatgtttcaggaataaaaaccacaagcttcacctctccgtc
EXON 5  115 bp
tccctgaggagggatttagcatttgagggaggaaagaaccacatatccccctacacgagt
gttattttctttggagatccaactgtattaacatcctcagagaaatctgattataaaaaa
atgggggatggggtaaggaggattcagtaagagttgccctccgctcaccttgtaccctag
GTGCATACCTGAGTCTCCCAGGTGGCTGATCTCCCAGAATAAGAATGCTGAAGCCATGAG
AATCATTAAGCACATCGCAAAGAAAAATGGAAAATCTCTACCCGCCTCCCTTCAG
gtgagccagggccttaagtatcaaatcaggggatggagaaaagggaggctctggtaagat
tcatgcatgccagtgatctcagcagggaaccatggaagcacccacccccttgcattttgg
cttacctgtagcggaatgcaacagagaattttatatgctaagatttgtggttccgtggga
EXON 6  107 bp
ttcagtctcaaaaaaaaaaaaaaaaaaaaaatgaaatgggacacagtatggaaagtgctt
gctctagtgctgggcatgagatgggcgctcaggacggtaagaaattattgttattcccta
tgtgacccagggacactagcattaaatatacaaagccgtcctttctattccttttcttag
CGCCTGAGACTTGAAGAGGAAACTGGCAAGAAATTGAACCCTTCATTTCTTGACTTGGTC
AGAACTCCTCAGATAAGGAAACATACTATGATATTGATGTACAACTG
gtaaggaatatttttcactttgaaatgcctccaaattgttttaatcacagtcatccatag
taaggaagggaagaaaacatgacctcatcccggtattagcgctgacggtgggcagcaatg
tgggttgtgtctggtaggttttcctgatcgtgtttttcttgggcaaatattaagatcggt
EXON 7  215 bp
ccagccacagccagccactgaagtagatcagagattataaaagcagtgggatgggggact
agcaaggagatggtcacagggaaaggtgacctacaatccacattatttttccagaagcct
ctcttttttggtgccctgtgtttggtgcttgacttgacctgaactctcctctttgctcag
GTTCACGAGCTCTGTGCTCTACCAGGGCCTCATCATGCACATGGGCCTTGCAGGTGACAA
TATCTACCTGGATTTCTTCTACTCTGCCCTGGTTGAATTCCCAGCTGCCTTCATGATCAT
CCTCACCATCGACCGCATCGGACGCCGTTACCCTTGGGCTGCATCAAATATGGTTGCAGG
GGCAGCCTGTCTGGCCTCAGTTTTTATACCTGGTG
gtaagtttcaggtgaagttggagtcttatctccaagaccctggagaaagggagtgtcacg
gcccattgataggaaaaccatgtaatttgtcatccaaatcaatttggaaagacaaattgg
agggcagtatctgggacccttctgagcaaattcatatggccagcctccctttaggaaaaa
EXON 8  109 bp
aggttaagatgaacaaacgtgagaatctgctgacattaacatgagcctatagaagaagtc
atttttctttcttgtcccattctgggatggggaatttgtccttacagtcccactctggag
cactgtctgaagatgaggaatcatctgtgtacggataagtactgttcttttccctcttag
ATCTACAATGGCTAAAAATTATTATCTCATGCTTGGGAAGAATGGGGATCACAATGGCCT
ATGAGATAGTCTGCCTGGTCAATGCTGAGCTGTACCCCACATTCATTAG
gtgagtgcattttccttagaatgacgagggtgggtgagacatttgttcattggctggaac
caccacaagtgcagacaaaggatatcttaccttcaaaacacagtgtaagggaaggtgaga
acacgtaaaggtccagccaggcccagcagttcacctctcacacttacaggctggggtaaa
EXON 9  113 bp
tgtatgaataagttcttcagtggtgatttctgagattttggtgcacccgtcacctgagca
gtgtacactatagctcttgaacattttaattatttgaggaagtgtttattcaggggtgga
tgggagataactactgcactgtgataagttaacaagttaaatcagtttcctgcattctag
GAATCTTGGCGTCCACATCTGTTCCTCAATGTGTGACATTGGTGGCATCATCACGCCATT
CCTGGTCTACCGGCTCACTAACATCTGGCTTGAGCTCCCGCTGATGGTTTTCG
gtaagaaatcttcacagatgtctttaagtgaaaacttatttttctagagaccttcacttc
tcttctacttcattcaaaacaggtgtcatgcctattagtaactactaattactactcata
gtagtaatgatgtgtctgtggcttgcgttcttcctggatgtgcctagtaattagtaatat
EXON 10  100 bp
gagtttggaactggtataatatttataatggaaaatacagcagtcagagatggcaaagga
atctgtaaataagtatagaaaaatgctaaaaaaaagttttaaacaaaaataagggaaact
ctaattatagaccttgagtttttcagttcttaatgtgatattcatctgtttggctttcag
GCGTGCTTGGCTTGGTTGCTGGAGGTCTGGTGCTGTTGCTTCCAGAAACTAAAGGGAAAG
CTTTGCCTGAGACCATCGAGGAAGCCGAAAATATGCAAAG
gtaggcagttgaaagttctaaatgaattgttctataaaggttttaagacaaccctatagc
catttggaaagaattaaattgactttatacttcacaccatacactgagataaattcaaac
taaatcaaagacttgaaagcatcaaaaaaattagtaaaattacaaagacattatacgaga
EXON 11  741 bp
ttatcaacaagttctgtccattttctttgtgagaaccaccactcagaacacattgcaaga
ctaatcctgaacaaagtttataatcatttgttgttcctctcatttattacccactttatt
ttggttttcagcctcctcataatttctttctcccctctccatttttatttcttattgcag
ACCAAGAAAAAATAAAGAAAAGATGATTTACCTCCAAGTTCAGAAACTAGACATTCCATT
GAACTAAGAAGAGAGACCGTTGCTGCTGTCATGACCTAGCTTTGATGGCAGCAAGACCAA
AAGTAGAAATCCCTGCACTCATCACAAAGCCCATACAACTCAACCAAACTTACCCCTGAG
CCCTATCAACCTAGGTCTACAGCCAGTGGAGTCTATTGTACACTGTGGAAAAATACCCAT
GGGACCAGATCCTGCCAAATTCTTCCAGCTCACTTTATTCTCAGCATTCCTAGGACATTG
GACATTGGTTTTCTGGAGGGTTTTTTTTCCATCTTTGTATTTTTTTAAATTTGATTCTTT
TCTTTGCAATGCTATCTAACCAGAATACATAGGGGAACTGTGGGCTAGGCAAACAAAATA
GAAAAAAGTGTGAAAAACAGTAAAGTTGGGAGAGGAGCATCTATTTTCTTAAAGAAATAA
AACACCCAAAACAATATAAAGTTGTCCAGAATGTATGTCAAGAATTTTAGATAGGCCTTT
CAGTAACACAGGTGAAGAAATTTTTAAAAATACATTGATTATTATCTAGGTTAGACTTAA
AGTGAATCTCAAATAAAAGAATCAGGAATACAACTTAAGTGATCATGAGGTCCTTCCATA
TTTAGATTGGGTAAGCATGAATGTGTATTTTCTACAAAAGACCTTGAGAAGAGTTCAATA
AAAAATGTTAGCATTATAAAA
ccattgatgatcattttttagtctggtaaaaatgtcttaacatttgtggattttaaaata
catgttaatattttataaaagtaatattatgaatacatttttaaaagctaaatatcataa
gacttataatgaaaacaaaatttccttgccctatttcacctctactaatttctcagagaa