Gene PRDM1 Variant 1
DNA : 21.19 KbNT_025741
mRNA : 2612 bp NM_001198
CDS : 2370 bp NP_001189
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  154 bp
tcaaagggaagtaagaagattccaagtcaatgttgaaatacacatgcgaagagaggaagc
tctcggcggctgtgctagcaatctgggggaaagccctgggctcggccaggtggtgttggc
cacgttggccacgcccccacttcgcgcagccgagtggctaaggaaatcttaagcagggag
GGGAAGCCAGACGGTTAACACAGACAAAGTGCTGCCGTGACACTCGGCCCTCCAGTGTTG
CGGAGAGGCAAGAGCAGCGACCGCGGCACCTGTCCGCCCGGAGCTGGGACGCGGGCGCCC
GGGCGGCCGGACGAAGCGAGGAGGGACCGCCGAG
gtgcgcgtctgtgcggctcagcctggcgggggacgcggggagaatgtggactgggtagag
atgaacgagacttttctcagatgttggatatttgcttggaaaaacgtgtgggtacgacct
tggtaaggaacttgaattttttttttttaattctgaaattgatctgaaaactttattttc
EXON 2  249 bp
aaccttgcttcttttcaaggcagtttactttatacggcttcttggctctttctcaactgt
accaagcactctgcatctgcttttaaagtcttcagactactgtattagtcatagcctctc
agaaggagccacaggaacggcgggacaatggggattaaaggcctttcctttctcttccag
GCTGCCCCCAAGTGTAACTCCAGCACTGTGAGGTTTCAGGGATTGGCAGAGGGGACCAAG
GGGACCATGAAAATGGACATGGAGGATGCGGATATGACTCTGTGGACAGAGGCTGAGTTT
GAAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGT
ACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAAC
AGTGAAGAG
gtaagcctctggtttattgacaagaagattggggacctggtgccaaatctccctacttgc
ccttgaggccttgtatatctctgaaaacctctgagaatctgtaagtatcagtaaataatt
gattgctctattcaattcttgcattgctttctctttccctaaaccatttccttctcattt
EXON 3  120 bp
gatggtctccccctatggtgaagcttgttaattatgtaggcatcattaatgtctgtttac
ttatcaaaattttatcattgttagttgtattactacttgacagtccaatttatttaattg
aaaagattggttaacattttatagtcaaagtaattgtttcctgtgttttttcctgtttag
GTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCTAATA
GGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGG

gtaagtaagggaaatttcttcagacccattaaatgttaggaaaaaatggagctaaaagag
ctgggtggctcacctttctcatcctgtgctgagaaatgctggggctcacccataagtatc
cagcatccccatggacacagggaattctgaacaaatgtgatgaaaccgatgaaatgtctg
EXON 4  253 bp
tgtttccgccctgatttctgctgattcaagactattctggctaaactgattggattcttt
ttctaactaggcagtaggggatcagaaatcacacacggtaccggctgtgtttattctgag
aggtgctggggagctttgggtctgacttccttttacatgcctgtcttctcttttggacag
ATCTATTCCAGAGGGGAGCTTCACCACTTCATTGACGGCTTTAATGAAGAGAAAAGCAAC
TGGATGCGCTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAG
AACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTT
GTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACA
ATGATGAATCTCA
gtaagtggattacagaacaaaaaaataaaaaatgccagtaatgtcggttctgcccctttg
aactaataacatgttgtttaattatacggctttgtcatgtgttggatgaagtaggtggct
taagctagggactaggaagaggaaaaacattttttgagtccctattaactattaggaaac
EXON 5  1109 bp
ctgcacttttgagtgagtggcccagagccttctagaatgagagtgcgttggaagccagat
atgtggcgattgtgtcgccagctgttactcaggttttctcaagaaggaggagcaactttg
gcagttttgcttcagttctctctagccctctgtgtaatcgcccctttttctttatttcag
CACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCAAAGA
ATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACCCCTCCA
AAGGAAAGGACCTCTACCGTTCTAACATTTCACCCCTCACATCAGAAAAGGACCTCGATG
ACTTTAGAAGACGTGGGAGCCCCGAAATGCCCTTCTACCCTCGGGTCGTTTACCCCATCC
GGGCCCCTCTGCCAGAAGACTTTTTGAAAGCTTCCCTGGCCTACGGGATCGAGAGACCCA
CGTACATCACTCGCTCCCCCATTCCATCCTCCACCACTCCAAGCCCCTCTGCAAGAAGCA
GCCCCGACCAAAGCCTCAAGAGCTCCAGCCCTCACAGCAGCCCTGGGAATACGGTGTCCC
CTGTGGGCCCCGGCTCTCAAGAGCACCGGGACTCCTACGCTTACTTGAACGCGTCCTACG
GCACGGAAGGTTTGGGCTCCTACCCTGGCTACGCACCCCTGCCCCACCTCCCGCCAGCTT
TCATCCCCTCGTACAACGCTCACTACCCCAAGTTCCTCTTGCCCCCCTACGGCATGAATT
GTAATGGCCTGAGCGCTGTGAGCAGCATGAATGGCATCAACAACTTTGGCCTCTTCCCGA
GGCTGTGCCCTGTCTACAGCAATCTCCTCGGTGGGGGCAGCCTGCCCCACCCCATGCTCA
ACCCCACTTCTCTCCCGAGCTCGCTGCCCTCAGATGGAGCCCGGAGGTTGCTCCAGCCGG
AGCATCCCAGGGAGGTGCTTGTCCCGGCGCCCCACAGTGCCTTCTCCTTTACCGGGGCCG
CCGCCAGCATGAAGGACAAGGCCTGTAGCCCCACAAGCGGGTCTCCCACGGCGGGAACAG
CCGCCACGGCAGAACATGTGGTGCAGCCCAAAGCTACCTCAGCAGCGATGGCAGCCCCCA
GCAGCGACGAAGCCATGAATCTCATTAAAAACAAAAGAAACATGACCGGCTACAAGACCC
TTCCCTACCCGCTGAAGAAGCAGAACGGCAAGATCAAGTACGAATGCAACGTTTGCGCCA
AGACTTTCGGCCAGCTCTCCAATCTGAAG
gtaggccttgagagagagcagtccaaggggctgtgagtgcatgcttgtgtttgtatttag
cttgctttccatggggtatcgattgcatttgcagtagtatgagcccccggttggggatag
tgggtatggattccgcctggcttttgccacttctagctctttgactttggacaagtgact
EXON 6  129 bp
gcctgtgatttttgtgcttttaagaaaaacaccattctgaaaacatgaagatttcttctt
tttaagactgtcttgatgcttttcttaagatatttgcatcaacacttgagtcttggagca
gaaatgttaggtctcagagccagcttgagagcagagctaacacatgtggcttcttcccag
GTCCACCTGAGAGTGCACAGTGGAGAACGGCCTTTCAAATGTCAGACTTGCAACAAGGGC
TTTACTCAGCTCGCCCACCTGCAGAAACACTACCTGGTACACACGGGAGAAAAGCCACAT
GAATGCCAG
gtgcgcagtattttctgggtagaccttctgacctttgtagaaaatgtctgtgagtcaccc
tcccatgtcctatatagcccgtagttaaagccaacaccagattctgcgttgtcccatcct
ggactgatggcactatggtccttcccagtactttgtatctgctgatgacttgagatggca
EXON 7  598 bp
gtgtgctgtgtgcccacatccccccgtttgcttaataccacactggaggtgccacaagga
ggcttctcacctcctaggttgctgggcgttggccggtaagcctgcccctcccgttggcaa
ctcttaatcttctggccttcctgtctcccttccctgctgtctctctcccctacactgtag
GTCTGCCACAAGAGATTTAGCAGCACCAGCAATCTCAAGACCCACCTGCGACTCCATTCT
GGAGAGAAACCATACCAATGCAAGGTGTGCCCTGCCAAGTTCACCCAGTTTGTGCACCTG
AAACTGCACAAGCGTCTGCACACCCGGGAGCGGCCCCACAAGTGCTCCCAGTGCCACAAG
AACTACATCCATCTCTGTAGCCTCAAGGTTCACCTGAAAGGGAACTGCGCTGCGGCCCCG
GCGCCTGGGCTGCCCTTGGAAGATCTGACCCGAATCAATGAAGAAATCGAGAAGTTTGAC
ATCAGTGACAATGCTGACCGGCTCGAGGACGTGGAGGATGACATCAGTGTGATCTCTGTA
GTGGAGAAGGAAATTCTGGCCGTGGTCAGAAAAGAGAAAGAAGAAACTGGCCTGAAAGTG
TCTTTGCAAAGAAACATGGGGAATGGACTCCTCTCCTCAGGGTGCAGCCTTTATGAGTCA
TCAGATCTACCCCTCATGAAGTTGCCTCCCAGCAACCCACTACCTCTGGTACCTGTAAAG
GTCAAACAAGAAACAGTTGAACCAATGGATCCTTAAGATTTTCAGAAAACACTTATTT
tgtttcttaagttatgacttggtgagtcagggtgcctgtaggaagtggcttgtacataat
cccagctctgcaaagctctctcgacagcaaatggtttcccctcacctctggaattaaaga
aggaactccaaagttactgaaatctcagggcatgaacaaggcaaaggccatatatatata