Gene POU5F1 Variant 1
DNA : 1.93 KbNT_007592
mRNA : 1155 bp NM_002701
CDS : 798 bp NP_002692
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  342 bp
gtgatctgcccacctcggcctcccaaagtgctggaattataggcatgagccaccgcgccc
agcaaagaacttctaaccttcataacctgacaggtgttctccctcgaggccagggtctct
ctttctgtcctttcaccatgcttctgcatccccttggatgtgccagtttctgggggaaga
GTAGTCCTTTGTTACATGCATGAGTCAGTGAACAGGGAATGGGTGAATGACATTTGTGGG
TAGGTTATTTCTAGAAGTTAGGTGGGCAGCTTGGAAGGCAGATGCACTTCTACAGACTAT
TCCTTGGGGCCACACGTAGGTTCTTGAATCCCGAATGGAAAGGGGAGATTGATAACTGGT
GTGTTTATGTTCTTACAAGTCTTCTGCCTTTTAAAATCCAGTCCCAGGACATCAAAGCTC
TGCAGAAAGAACTCGAGCAATTTGCCAAGCTCCTGAAGCAGAAGAGGATCACCCTGGGAT
ATACACAGGCCGATGTGGGGCTCACCCTGGGGGTTCTATTTG
gtgggttcccctctgcagattctgaccgcatctcccctctaaggagtatccctgaaccta
gtggggaggggcaggggcagactctaccctcacccatgaagaggagtagggagagggaga
agatgcttgggctttgagctccctctgggaagaggtggtaagcttggatctcagggtcac
EXON 2  131 bp
gaacctagtggggaggggcaggggcagactctaccctcacccatgaagaggagtagggag
agggagaagatgcttgggctttgagctccctctgggaagaggtggtaagcttggatctca
gggtcacaagggccctgcgtgctccctcattttgcttctcttttgactggcctcccccag
GGAAGGTATTCAGCCAAACGACCATCTGCCGCTTTGAGGCTCTGCAGCTTAGCTTCAAGA
ACATGTGTAAGCTGCGGCCCTTGCTGCAGAAGTGGGTGGAGGAAGCTGACAACAATGAAA
ATCTTCAGGAG
gtaagggtgggagggggatacccggggaccttccctttcttggcctaatttccattgctt
ccatcactggctcgtagctctccgtctttggtgcagtggttctcagtgggatggagtgaa
attcctcagttctgctgggataaggtccagagccaacccttccaggatcctgccttttca
EXON 3  159 bp
agtgggatggagtgaaattcctcagttctgctgggataaggtccagagccaacccttcca
ggatcctgccttttcacaccaccacctggctctgctgacacatctagtcacagacccctg
tgatgctgttactcagcaagtccaaagcttgcccttgtcacccccttcccacctgcacag
ATATGCAAAGCAGAAACCTTCGTGCAGGCCCGAAAGAGAAAGCGAACCAGTATCGAGAAC
CGAGTGAGAGGCAACCTGGAGAATTTGTTCCTGCAGTGCCCGAAACCCACACTGCAGCAG
ATCAGCCACATCGCCCAGCAGCTTGGGCTCGAGAAGGAT
gtgagtgccatgtctctctgcgggctccatctctttcccctgtcaccacctcgctttccc
tagctctggctcctccaactgctctagggctgttggctttggacagaatgtccaagcagt
caggcctgtctcagctcattctctaatgtcctcctctaactgctctagggctgttggctt
EXON 4  523 bp
tctagggctgttggctttggacagaatgtccaagcagtcaggcctgtctcagctcattct
ctaatgtcctcctctaactgctctagggctgttggctttggatagaatgtccaagcagag
tcaggcccgtctctcagctcattgtctaatgtcattctcctttctgtcattcactggcag
GTGGTCCGAGTGTGGTTCTGTAACCGGCGCCAGAAGGGCAAGCGATCAAGCAGCGACTAT
GCACAACGAGAGGATTTTGAGGCTGCTGGGTCTCCTTTCTCAGGGGGACCAGTGTCCTTT
CCTCTGGCCCCAGGGCCCCATTTTGGTACCCCAGGCTATGGGAGCCCTCACTTCACTGCA
CTGTACTCCTCGGTCCCTTTCCCTGAGGGGGAAGCCTTTCCCCCTGTCTCTGTCACCACT
CTGGGCTCTCCCATGCATTCAAACTGAGGTGCCTGCCCTTCTAGGAATGGGGGACAGGGG
GAGGGGAGGAGCTAGGGAAAGAAAACCTGGAGTTTGTGCCAGGGTTTTTGGGATTAAGTT
CTTCATTCACTAAGGAAGGAATTGGGAACACAAAGGGTGGGGGCAGGGGAGTTTGGGGCA
ACTGGTTGGAGGGAAGGTGAAGTTCAATGATGCTCTTGATTTTAATCCCACATCATGTAT
CACTTTTTTCTTAAATAAAGAAGCTTGGGACACAGTAGATAGA
cacacttatcttggtttgtccttcagttactgaggtggggatgggaatatccaatgctca
tacccaagtgaccctgaaactaaggtgccatttacactccttaaggtcacacaacatcag
agggagagctgggattgcagccaagtttatttgtacagggccctgtgataggctagttcc