Gene PNLDC1 Variant 1
DNA : 20.43 KbNT_007422
mRNA : 1920 bp NM_173516
CDS : 1563 bp NP_775787
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  115 bp
attgcaatcaaacctctgtagcaaatcgtacaattaaaacacccgcaggcaggtgtgggc
gacgccagcagcacacggggaagctgggcacgtggggcggaggcagctgcctggtttcca
tgtgtgcgccctttaagacccggcggcgcgacggaagcgcgtgggcagcacgtgggcagc
ACGTGATAGCGCTGGGCGACTCCGCGGAGCTGCACGGCCATGGACGTGGGCGCCGACGAG
TTCGAGGAGAGCCTCCCTCTGCTGCAGGAGCTCGTCCAGGAGGCCGACTTCGTGG
gtgaagagcctgggattcgcggctgtgccggacagagccccttgccccgggcgagcttga
ggagggggtggcgggacggttgccaggccacagggcctcagagagggcctcgggaaggac
aggggggcttccttctccagccccggggcggtgggactttgagcagcaagtacactccga
EXON 2  157 bp
tcgggaaggacaggggggcttccttctccagccccggggcggtgggactttgagcagcaa
gtacactccgagccccacgtcccttgttggccagagccccgtgcgcccaggtgcctggct
gctccttgccttggttcctccattttcccttcctgacctcacttggcttcttgagcgcag
AGGTGAGCGCGGGTGCCTTGGCCGCCTGCAGATCTACAGTGTGAGGAGTGCTGGCGATGT
TCTGCACCCGAGGACTGCTATTTTTTGCCTTCCTGGCAGGTCTGGACATAGAGTTCACGG
GCCTTCGTTCTAACCTGTCTGGGCCCCAGCAGATCAG
gtaaaactaaagctgtgtcccctctgtataagagcctggccagaccagcactgtttctgg
ccagcagcctgttggcatttggggggcaggacgttttgtgtggcttgctcctacgtgttg
gaggaccttgcttttttctgtccactaaatgatggtagtgctccctagttgttgtaacaa
EXON 3  74 bp
cttgctcctacgtgttggaggaccttgcttttttctgtccactaaatgatggtagtgctc
cctagttgttgtaacaaggaaaaaatcctccccggttgcgagtggtggtcctgccgcgga
ggccatagtgccgggatgggatgtcattgctcgtggaatgagatgcctgtttgttcacag
TCTTTTTGATTTGCCATCGGAGTGGTATCTAAAGACCCGTCAGAGTGTTCAGCAATTTAC
AGTCTGTCAGATTG
gtgagtttaatatcagctgttagagtttttcaagaaggtatttttattgtccttggattt
cctactgtaaaaacagctctgagatttttcaaggatattgagtatcgttttgtatgcttg
ttttgtgttgggccattgtatacatatggaaatcaacacttcggagcaaaccaaatttag
EXON 4  40 bp
atttgacatttctcatgcttccagtctgtcttttcttttttgtcattaaagatgttatcc
tgttgtacagcccacatagtatctgtgggcgcaaagtactgtttgagttgtttttgtctt
tgtagtgaaattcaggttgcttttccttggcattcattccctctacggtcattcttccag
GATTGTCTGTGTTTTCCGCTATTGAAGGAGAGGCAAACAA
gtatgtatcaagagcttctgcaaacataggtgcttcccacctatgttccacagctgccac
cttcaaattctgcctcaggtgccccgatcacttttgccctggatcttccgtattctctcc
tgtgtctgttcctccactcactctgccctctgcggattccagcttgtctttgatgtctct
EXON 5  124 bp
ctctctgcctttttcatttagcacccccagtgccaatcatagctcctgaaacacagcaga
cactcgggcacactcagattcttcttgcctaaaagaaagagcccaccctgaagccagccc
tgggagccagagttttttaaatggttgtggctttttctctgtatgtttgttttattatag
GTATATAGCCCATTCTTGTAACTTCTATCTCTTCCCTACAACGTTTGGGATTTTGGACTC
AGAATTCTCCTTCCAGGCTTCCAGTGTTCAGTTTTTGAATCAGTATGGCTTCAACTATAA
CAAG
gtatggcattggaggaggggaacgggaatgtcttttgtttgtttctgagatggagtctcg
ctctgttgcccaggctggagtgcagtggtgcaatcttcgcctcccgggttcaagtgattt
tcctgcttcagcctcccaagtagctgggattacaggcacccgccaccatgcccagctaat
EXON 6  89 bp
gctggggttataggcatgagccaccgcacccggcctgggaatgtcttacaagtgatctag
acgaactggcttatacagcccgtctcctttcccctttctacctgtcctcgtgaaatcagg
cacagaggatccctctgacttgtctccttgttctgtttgttgttctgtttctgtcttaag
TTTCTCAAAAACGGAATCCCATATATGAATGAAGAACAGGAGAAGAAAATTAGACACGAT
ATCCTGACTGGGAACTGGAGAGTTCGCAG
gtatggcctgtttctccaggtgcctttttgtttccttgttgctgttgtctgcatttcccg
tgggcgggcgtgccgtttccaggagtgtggtgacctccatccatgcttggcggggatggc
ttcagctgcctgtgcagctggcgctgctctccctgtgccccaactgagaatggctttcac
EXON 7  101 bp
attgtttggcttcctattgcataagagcctcagagaagaaatcgtcttcttttggtacat
tttctttgtatattgcaacatgaaaaccagagggttcagaaactgctctcatgttaacat
agtcttgcggttctgaagtgtttttctctgacatgttcactttcatgcgcccattttcag
CTCTCCGGATAAAGACCAAATCAAGGTGGTGATTGACGAAGTGACGCGGTGGCTGGAGCT
GGCCAAGGAAGGCGACTGGATGACTCTTCCTGGGATCACTG
gtaggcagggcctgttcctcccaacgcaggagcattgggacaggtcactgtcacctgcca
ggagttgggggaaacacaccctttcttgggatcctggtcccaagtgcctcatgactgagt
ctgatgcaagcatttgtttggcggttacggagtctttgtggttaaagttctgacctgcat
EXON 8  77 bp
tgccccagatcccatcatgacaggccaggccctgccacatggctcatgggcttgggcacc
cttcaagctccctttccacttgacctttccatctcagcttctgctcctccagggcttctc
ttgtggggaacatgccacacggttccaggtgctgtgtgcccctgtgtttccctgctgcag
GCTTCCAGGCCTTTGAGGTCCAACTGGTGCTGAGGCAGGCCCTCCCCAACATCTGGACGG
TGCTGAAAGATGAGGGG
gtgagttctcactgcgaacggggcatcagtggctccattgtttctctctcataattggcc
aaatctggcctctgaaaagcttttatcttgcacgctgctagtttttccccctttcctttt
gtttagagatgcagagccatttctttaggcctcattcctagtaacccaggattcagggaa
EXON 9  144 bp
cggggcatcagtggctccattgtttctctctcataattggccaaatctggcctctgaaaa
gcttttatcttgcacgctgctagtttttccccctttccttttgtttagagatgcagagcc
atttctttaggcctcattcctagtaacccaggattcagggaatttgtccctgcttttcag
GTGGTAGTGAAGAAAGTGAGTAAACAACATCGTTGGTATCTTCAGAACACCTCTTGTGAC
CGAGAGAGCTGTTGGAAGGAAAATATTCTTCTCTCAGCAAGGGGTTTTTCTGTCTTTTTC
CAAATGCTGGTGAAAGCCCAGAAG
gtaggaaaacatgtctcttttcttggcctaaaggcagtctttagtatttctggtcataga
tactaaaggctccttcaacaacaagataaaattctttgagataagtgattccttctcatg
aattttttcatgttttactttcagatagggtctcacctgtcacccaggcaggaaggagtg
EXON 10  70 bp
tgttggcatttaagcggttgaactacctttcacagaggcaaaggaaggttaggatggaac
tgtcaagtgatcagaattgcagtgggttctaacactatatcttttgcaagaaactgttag
tctgtagtgtctggattacatttttttattttctctcacctgttgatttactccaagtag
CCCTTAGTGGGACATAATATGATGATGGACCTGCTGCACCTCCATGAGAAGTTCTTCAGA
CCCCTCCCAG
gtaggggcaaacctgtcatttctcttccttcacgctagtttgccatctggcagagggatt
ggtacacaatcatacccctgaggcagctcctaaaatgcccattcctccccagtgtctgca
ggtttctggagagtttgggcagaggcctgtactctgatctgttactgtctccccagagtg
EXON 11  86 bp
tggcagcttgatctgagtttagaaatccttagtggctaggattaatggtgttttcaattc
ctgttttgtttcagtttgctttattaatcagtgccagtggcaagctaggttcaagaatgt
tccttcccatttttgccaacaaacaaattcactcttgactacctgggtttttcccctcag
AAAGCTACGATCAATTTAAGCAGAATATCCACAGCCTATTTCCTGTTCTCATTGATACCA
AGAGTGTAACAAAGGATATCTGGAAG
gtaatgaatagaactgctttgggttaagaactgctttttccataccagtaacacttagct
ttctcttgtggggtttttttcttgtgtttttttgttttttttgttttgttttgttttgtt
ttgttttgtttgagagggagtcttgctctcaaagccaggctggagtgcaatggcgcgatc
EXON 12  56 bp
atactgcgtaccctgacatcctaactaaggaataaggatggttgcaccatttgaagagaa
agaggaggttgtaggagtgagcattttccaggccattttaatgaccatttggtactgcct
gaaacagagaataaacaaaagcgcaaatgttttcctctggtttgttttccatgattgtag
GAGATGAATTTCCCGAGGGTGTCGAATCTTTCGGAAGTCTATGAAGTCCTGAACAG
gtgaggacggcgattcctggagctactgctggagcggccttggtggcctccctgtgctcc
gcaggcctttgggctctctaggcgtgcccaccattcacagtgatgcctgcttgggacttg
gtctcctccagctcctcctgcttcatggcccccttcctccgatgaccctcttgcctccgt
EXON 13  65 bp
ctttcccctttcctgttgcccagttactaagatcttacctgtccatgcttagatttgcac
cttaaagatatgtcctcagtacatttaaaaaatttatattaacttaagggactgaggggg
aatacaagaagggattactttcagcaaattgttttttattctatttttcttttccaatag
TGACTTGAATCCCACCAAGAATTCTGGACCAGAGATTGTTCACGCGAGCAGGTGTGAGAA
ATATG
gtacgttcccatgagcccataatccttgcacagtcggcagagtgctgaggtgctcagctg
agcttgtccttgaccctggttcccccacacccctccccacccacccgccacacccctccc
cacccccccacacccctcccctcccccccacctctccccctgccccgccccaggcagcag
EXON 14  54 bp
atcttggggctttctccaccgtggggaggaccaaggtgaagttggtgtgtgggcctggag
aagggtatgcaggaccatgggaggttgtatgagctgcagccactgtggatggtgagctag
gatggggcgtgtttctaatgactgctcaattctctgtcctcctggtggaaaatgcctcag
TTGAGACAAAGTGCCCCCACGAAGCCGCGTATGATGCCTTCCTCTGTGGGTCAG
gtaaggattgcggttcctttaaaaggaaactcactttttttttttttttttctgagacag
ggtctcactctgttgcccaggctagagtacagtggtgaggatctcggctcactgcagcct
ctacctcctgggctcaggtgatcctcccacctcagcttcccgagtagctgggactacagg
EXON 15  43 bp
tgctgggattacaggcatgagccaccacacccagctggagacttactttttgttggcagt
atgcccctgccgtccctagattctacatttatttcagattggcttgcacataatgagata
aagcataagcatgcacattttgataagctctattgcatttctgtcttttttccttcctag
TTCTTTTGAAAGTGGCACACTTGCTTCTACAGAAGATATACCA
gtaagtgttctttcttttcatcctactgttcaatcggtggtcaggatttattgagccctt
gctggaagccaacacctctccagtcccagggttctaccaaagaagggagaatgtgaggtg
tcactggtatagaaatcttgtccctgactgggcagcagcccacaaatggctctgtgccac
EXON 16  100 bp
cttttagacttgccagctggggaagcacccaaccagagccccaagacttgtgagggcagg
agggagggagagccgtccgagggagtgtccttctgttctgtcaccggattcttggctgtg
gccgaggaagtggatgaacttctgtgcgcccgacagctttggggttttctgtccttgcag
CATCGACCCCGTGCCCGAGTCATCCTTTCCTCAGTACCTTGACGTGCTGGCTCCTTACGT
GAACCAAGTGAACCTCATCCGAGCGGGGGTCCCAAAGATC
gtgagtagatctcatttggccccctcgccccattcagagttcagaggctttgctgggaag
cggccagtgctctctgggactcgtgagagggatttcggtggtcggtgagatgagagctgg
gtttttctttcctctcatgtttctccactaaagccaacatggactcatccttccttctct
EXON 17  176 bp
gagagctgggtttttctttcctctcatgtttctccactaaagccaacatggactcatcct
tccttctcttcccctccctgccccaagcagagcctttcctagtttcttttgagatcttca
gactggataagaagtcaggaagaactgtggaaaatctcttgtgttctgcatgttttctag
AATTTTTCTGGTCCAGATTATCCCAGTATCCGACCTCCCATCCTCATCCTCAGCGTCAAA
AGGTGGCCTGGGGTCAGCGAGCAGCAAGTCTACCATAAGTTTCAGAATCTCTGCAAGTTT
GATGTCAGGCGACTCACAAGAAGCCAGTTCTTACTCCTGACCAATAAGTTTAAGGA
gtaggtgcctctaagtccgcgtcccccacccctcgtgcgttcatccctgtatctctctga
ctccacccgcctgatcacagcaggcggcgccatcctgctgcctggctgaccacagcaaac
ttgttttggcagtgcgcggaacatcctgaaggagtaccgggaccacccgaccctgtgcat
EXON 18  99 bp
gcgactcacaagaagccagttcttactcctgaccaataagtttaaggagtaggtgcctct
aagtccgcgtcccccacccctcgtgcgttcatccctgtatctctctgactccacccgcct
gatcacagcaggcggcgccatcctgctgcctggctgaccacagcaaacttgttttggcag
TGCGCGGAACATCCTGAAGGAGTACCGGGACCACCCGACCCTGTGCATCTCCCTGTACCG
CTACTGGAGGCACTCCCCAAACGTCAACTGCCTGCTCCA
gtaagtgacaggctgaggccacctgcctgtcctggggtcctggagtgcccggggtcccag
catcccagcatggtctgactcgagcacagctcacttgctggtgtgtgttgccaagggggt
tgtgttgacgagtgtggtgccctgaatgtccttcagtgatgccgcgtgtctgtcgagcac
EXON 19  250 bp
gtttgcatcccagagccagcctaacctcgagaggcagaagttcagtgttgtcgtcgggag
agtgacagcaagaaagaacatctgagtgcacggggctgggaaggaggaggggcaagcctg
tgtcggtgcctctcggcctgctgggtgccccggccactgacacgtgtcattgtcttgcag
AGTCTGTGGCATAGTGACTGCCTGGGCCCTTCTCGCGTTCATCCTTGGAAGATCTGGTAC
CTGAGTGCAGCGAGGCCTCCTGCGGCCACCCTCGGGTCCCCATGCTCTCTGGGAGGTGTG
CTGGGTGTGTTCGTGTAAATCAGATTCTGTTTGCAGATGGATCTGTTTGGTCTTTTCTAG
AAATTCTGTTATGTCCTGAACGTGAAATTCTGTCAACACTCTCAATGATAAATCAGTCCT
TAGATATCGT
acctgtatgtgtggtcagaacttttcttgctataaatgcaggcggagcagtcagcacctc
gagatttaagctaatgtctcaggagcaggtcattgtgctaggagctggacaccagatgaa
gaaaaggggacgttatttctgggggaaaaactaatggcttattattggctgttgttgact