Gene PHF10 Variant 2
DNA : 19.98 KbNT_007302
mRNA : 1549 bp NM_018288
CDS : 1233 bp NP_060758
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  44 bp
gcgggcgggcggagggggcggggccggggcggcggggggcccgcgcggcggcggcggcgg
cggcggcggcagcggcggcggcggccgggacaaggcggaggcgacggcggcggcggcggc
gcggggcgctcgggctgatggcggcggcggccgggcccggggctgcgctgtccccgcggc
CGTGCGACAGCGACCCAGCCACCCCCGGAGCGCAGTCCCCGAAG
gtgaggaagcggccggtgcgacccgaccctgaccccgtcccgggcctgggtgccggggcg
tgggcccagtcccaccggcggccgcccagcgtctcgggggcgtgggcccaggccgggcgc
cgcgcctgagaccgggggtggtcggcgaggcggggccccgaggtgagcccgcggcctcta
EXON 2  107 bp
aagatcagttttaaattttattccaggtcttgctcatgccaaactcttggacccttttaa
ttataatatgaagttaatacttgtatgactagttgtccttagacagtctttcatttattg
agacttactgttcttttattctttctctaattattatttttgaatcttttaaatgtatag
GATGATAATGAAGATAATTCAAATGATGGGACCCAGCCATCCAAAAGGAGGCGAATGGGC
TCAGGAGATAGTTCTAGGAGTTGTGAAACTTCAAGTCAAGATCTTGG
gtactgtcattttatcggttattaatattttttgtgatgttcctctttgccttaacatcc
tcttccctttcccccagctctggcaaaggcaattattaaaaattgtagaatattttcttc
ctgttctataatgtgccatcaaagttggtcttgctactgagtgtaattaaaaagcaattt
EXON 3  131 bp
accagataattatttctattccttgtacctgttttgtaattttctttgatacacaggaag
tcaagtcataggaggcaaataatttaaatacttaaaatagttttcaaaatatcctcaata
aaagtgattaaaaattaatgaaagctacatttaatgcataatatgtatttctgtacttag
TTTTAGTTACTATCCAGCAGAAAACTTGATAGAGTACAAATGGCCACCTGATGAAACAGG
AGAATACTATATGCTTCAAGAACAAGTCAGTGAATATTTGGGTGTGACCTCCTTTAAAAG
GAAATATCCAG
gtactagtttatataatagattaatttataattgatagtaattctttatgatacactgtc
aacttctgaatttttctgtagattatattttatattcttgtgcttgctgtttttttttaa
gactaagggtctcattctgtaacccaggctagagcgcactggtgcgattatagctcactg
EXON 4  84 bp
acttttgtatcttgctgagttttatttcttgaatttataaatttttttgtagccccttta
ataatatttggaatatgtaatatgaatactttaaaaagtcaaggtttttaagcttttaaa
agttttacaagtgcataaggttttgctgtttttaatagtcttttgatcttttttttggag
ATTTAGAGCGACGAGATTTGTCTCACAAGGAGAAACTCTACCTGAGAGAGCTAAATGTCA
TTACTGAAACTCAGTGCACTCTAG
gtaagaatagctttttaatgtgaatttttcaagctgaacatttatgagataatactagat
aagtatcttatttcctaaaatattttacaaaattaataaaataaattgaactatttaaat
gctacattatttacttcatttttgattattgttaaaatacacaggagaatgaagcttgaa
EXON 5  134 bp
tcgagtttatattgtgaatattaagtttaattattttcaaatgtactaagatattttgct
ttggctattggaaaaccattacaacgtggagcggtttgaagaattaaattttgaagagtg
cttttgttcacttatccttaaaagagcttctttatttttttattttttggtctaaaatag
GCTTAACAGCATTGCGCAGTGATGAAGTGATTGATTTAATGATAAAAGAATATCCAGCCA
AACATGCTGAGTATTCTGTTATTCTACAAGAAAAAGAACGTCAACGAATTACAGACCATT
ATAAAGAGTATTCC
gtaagtaattgaggtgactggcattttttatttgggttggggaaaatgacattttagaaa
gttatatgtgacttccaactgtattttttttttccagcaaatgcaacaacagaatactca
gaaagttgaagccagtaaagtgcctgagtatattaagaaagctgccaaaaaagcagcaga
EXON 6  150 bp
atccagccaaacatgctgagtattctgttattctacaagaaaaagaacgtcaacgaatta
cagaccattataaagagtattccgtaagtaattgaggtgactggcattttttatttgggt
tggggaaaatgacattttagaaagttatatgtgacttccaactgtattttttttttccag
CAAATGCAACAACAGAATACTCAGAAAGTTGAAGCCAGTAAAGTGCCTGAGTATATTAAG
AAAGCTGCCAAAAAAGCAGCAGAATTTAATAGCAACTTAAACCGGGAACGCATGGAAGAA
AGAAGAGCTTATTTTGACTTGCAGACACAT
gtaggataacttaaatttagtaccccctgaacttagtttattacttgttattgcagagtg
cccatcaccccctttatcgttattttttgtaccacctatgtgtgtgtgttttttttgttt
gtttgtttgttttgttttgttttttgtggcagagtctgtgtagcccaggatggagtgcag
EXON 7  110 bp
caataatatatagaactgaaagcaccaactgtcctcttaggttatagctcctgatatctc
ctaaaattttagcttttcgagggggaagtgggcgtgcagtggtgagcacgtggggactct
tcctaaagccttgattcttagcatggaatcagttttgtgtttctctttatgttaacgtag
GTTATCCAGGTACCTCAAGGGAAGTACAAAGTTTTGCCAACAGAGCGAACAAAGGTCAGT
TCTTACCCAGTGGCTCTCATCCCCGGACAGTTCCAGGAATATTATAAGAG
gtatttagtagttttagttacagttggtatcggctattggtaaggggtttcagagccttt
tgtacttgcctcctaacaattttggggtctatagatatcaccgtaagatatcgtatagga
tttgtgttgctattcttctctggttctgtggtaaacaataccctgtagtcagaatttgaa
EXON 8  154 bp
gaaaagatgttcaggctttttattaaccctacttgatgacaaaaatgaaaaattagtact
ctagttttcaaaagtcttcggggttactcaagaagtttaaggctatcttcataggtcaaa
gatgagtctgtttatatttaataataaagggaaaccaaaaataaactctctgaacttcag
GTACTCACCAGATGAGCTGCGGTATCTGCCATTAAACACAGCCCTGTATGAGCCCCCTCT
GGATCCTGAGCTCCCTGCTCTAGACAGTGATGGTGATTCAGATGATGGCGAAGATGGTCG
AGGTGATGAGAAACGGAAAAATAAAGGCACTTCG
gtgagaacatttctctctagtaggaagcatttcctttctctttgaatttttgttacattg
aatttctgtcatcaccctctccttgaaaaaggatggttgcatgtaatttccagaaagtat
tcatcaataaaagttacttatagtatgttttgataaaaacaagcagtgaatggcctttgg
EXON 9  156 bp
tttaacataacttactttagtctccactggaaaaagctttcttacatttagaatgatctt
tttatttttaaaatgataaagctttaaaactttctttgaatattttccatagttttcaaa
atccagactcaaatttgtcttaattccaaagaatctttgtttttgccttttaaactccag
GACAGCTCCTCTGGCAATGTATCTGAAGGGGAAAGCCCTCCTGACAGCCAGGAGGACTCT
TTCCAGGGAAGACAGAAATCAAAAGACAAAGCTGCCACTCCAAGAAAAGATGGTCCCAAA
CGTTCTGTACTGTCCAAGTCAGTTCCTGGGTACAAG
gtagaagaaaaaagcccctgactcagcttctttactgaccagcctctccctgaaatattt
taacttgactttcacgattgtggagcttctgcctgctgtacctcactagctgttcttcta
tggtgtgccctttgtccgctgctttcttttttgctttatttccttggtggcttttctgtc
EXON 10  109 bp
tgctttcttcagtaggcagtcttacattgtaggcagactcctgtcaagttttgtctttca
aaatggtcctcattagcaagttaccaaaagtaaaaatagggcaataaagtaacagaattc
cttttaaacccatagtaagctcttctggcatgaatttatagccctcttctacccttccag
CCAAAGGTCATTCCAAATGCTATATGTGGAATTTGTCTGAAGGGTAAGGAGTCCAACAAG
AAAGGAAAGGCTGAATCACTTATACACTGCTCCCAATGTGAGAATAGTG
gtaagtattgaaatgtctttttaaaattttaaccaccgtatttattggttcaaaaactag
aatttatagtttcaggcagatttcaaccaaagagtcaccaaattaaatacacagggtagc
ttgtgaggcatagacacagcccatgtgttttcctctacattgtatattcatttctctttg
EXON 11  189 bp
ggtagcttgtgaggcatagacacagcccatgtgttttcctctacattgtatattcatttc
tctttggcgatttgacattatagccattctctggaagtcctaaagcaaactagtatttta
tgtgccatattaagttaaaatttcttatgtgagataccactaatactggttttgatttag
GCCATCCTTCTTGCCTGGATATGACAATGGAGCTTGTTTCTATGATTAAGACCTACCCAT
GGCAGTGTATGGAATGTAAAACATGCATTATATGTGGACAACCCCACCATGAAGAAGAAA
TGATGTTCTGTGATATGTGTGACAGAGGTTATCATACTTTTTGTGTGGGCCTTGGTGCTA
TTCCATCAG
gtaaagattaaaaaaagagcaaacattatctttgggtgatgagactctcccagcactcca
aaaggctgcataaacgctatcatgacatgaagagcttgtggactcttatgtgcaaatatg
accaaagctgtgattatacaggtcatgtccaccagcttttcatccctagacaattccaac
EXON 12  181 bp
tgattacattgattaagtttacattttttccttaaattaaggaactcatagtgcccttct
caccacaaaatccagagaggaatatcattagtgatagctaaggcagaagagtttagatgg
gcttaaaattcagtcctgtaaagataatttttcattctatattaacaatttttttcctag
GTCGCTGGATTTGTGACTGTTGTCAGCGGGCCCCCCCAACACCCAGGAAAGTGGGCAGAA
GGGGGAAAAACAGCAAAGAGGGATAAAATAGTTTTTGACTCTAATACTGTATATGCATTT
AAGTGGAATATTTGGTGCCATTTACAACATTATTTTCATGCCAATAAAAGATTTTTTTTG
C
aaattatgagcttaaaatctgcagttatttctgttaaaagctacgcttactctcgaaact
aactccaggtagagaattcatcttccaaagtattttatagtaaccttggctcactccaaa
aattcagtggaaatgtttagtaacttaagatacttaactgtttctccatagccccaaaag