Gene PGM3 Variant 1
DNA : 24.31 KbNT_007299
mRNA : 1992 bp NM_015599
CDS : 1629 bp NP_056414
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  38 bp
gcagccgcagttcctcaggcgccagctgcgcgcgacctgcggcgaggcgggggcggggct
ggcggatagtcctctgccgtgattggccagggggcgtggcgacgagccggaagccacgca
gggccacgtctgcggttctgaggactgggtttgggtgcagacgttgttgcttgggcgctt
CTCCGCTGCGTGTAGGTGAAGGGGGCTTCCTGACCGAG
gtaagccgggccccgaggctcggagttgagaagggagactaccggtcggcaagggctcgg
tgggagcgggacaggtcagattctcggcccgacggaggggctagtggtctggcgggcgac
tgaccgagcggcggagcgcgcgggacacacctacaggcccctgcgccccgcgggcgggct
EXON 2  206 bp
tcttgtaggtaattctaacccacaggacttactctcctgcccattgctctgtcaaacata
gggttctttgaggaggttcaggatgagacagacctattcgtttggggtggcagtttttga
agcaaatggttcttaagaaattacttgttatgcccgaaacaatatttcttaattttgtag
ACATGGATTTAGGTGCTATTACAAAATACTCAGCATTACACGCCAAGCCCAATGGACTGA
TCCTTCAATACGGGACTGCTGGATTTCGAACGAAGGCAGAACATCTTGATCATGTCATGT
TTCGCATGGGATTATTAGCTGTCCTGAGGTCAAAACAGACAAAATCCACTATAGGAGTCA
TGGTAACAGCGTCCCACAATCCTGAG
gtaatgggtttagtgccctgataaagcagaccattatttacaagaccaagccttagtgtc
tgagcaaattgacctaaagtacaaattctaattctaggaatgtgccttctcatttatatg
tgctttggatgtgaaacaactttttttttttaagagcatgatcattaagctcatgattcc
EXON 3  185 bp
atgaggtaatatatatacataaaatacctaatccagggtccagtattaatatttggtgtt
tattgttgaagctgctcagccatcactgtctttggttgaagggaaacagcttttgagttc
tgttctcaactcagcctcatgagtatgcacagattgcttattgtttgtttttcttttaag
GAAGACAATGGTGTAAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCATCCTGGGAG
GAACATGCCACCTGTTTAGCAAATGCTGAGGAACAAGATATGCAGAGAGTGCTTATTGAC
ATCAGCGAGAAAGAAGCTGTGAATCTGCAACAAGATGCCTTTGTAGTTATTGGTAGAGAT
ACCAG
gtgatgataagagttactggtaaaaaaaaaaacctttgggaacgtgatataaacgattgt
atcagttttaatccaagacaaatggaaagaagtaaagtggaactaccctgagttgcatgt
ctacctgcctggcctttctagtaggatgtagtagctaagtcactactgcagcttggggtt
EXON 4  68 bp
aggctactggaaaatgcttataatttaccagttatcttgagagttcatagctttcagttc
agataccaggaacttactattttgaaatttgtagcatgtaatttttgcatttgcttgcag
aaccagcaaccctgccagtttcaggatgggatatattattttcttccttttctttcctag
GCCCAGCAGTGAGAAACTTTCACAATCTGTAATAGATGGTGTGACTGTTCTAGGAGGTCA
ATTCCATG
gtatgtagttatcctgagttggaaattaaactaatatttaaaaaactttaatttacaaaa
gtaatgtatatttatttagaaaagtttgaaaatacagatgaacaaaaaatgtttaaaaaa
tgaactcctagatacaaaatactaactttaaaaatcatcttccaggtcgtttctgggcag
EXON 5  134 bp
tggttttttggcttcttatagtcatttatatttctttttaagatcatttttatgttttct
aagatgtctgagatgacacaaaaggatttgtcaccctgaaattcctacacatgaatgcat
ttaaacttttttctctttgttaagaaatgcggtgaattgctttttgtatttctatgacag
ATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTGTATTGTCGAAACACGGGTG
GCCGATATGGAAAGGCAACTATAGAAGGTTACTACCAGAAACTCTCTAAGGCTTTTGTGG
AACTCACCAAACAG
gtgaaaagtttattgaacatggttaaagttaaacaaatgaataaagtaacatggtctact
gaacaaattatcttgtttgtcatgcctcctctttccttttccaaagatgctgcatatctc
cttttttgtttttctctagggctacacaaggttctggtctatgtatcctgctaacttaca
EXON 6  196 bp
ttactttagtgttttataattttaaaaattgaaaaatgaacacaattataattgataaaa
tttaaaaattaaaatgagttaactaaatatttacatatgcacatatgtatatatgcttta
tatttcacatttatttttataacttgaaatttttcttccatgtgtctttttcctttgtag
GCTTCTTGCAGTGGAGATGAATACAGATCACTTAAGGTTGACTGTGCAAATGGCATAGGG
GCCCTGAAGCTAAGGGAAATGGAACACTACTTCTCACAGGGCCTGTCAGTTCAGCTGTTT
AATGATGGGTCCAAGGGCAAACTCAATCATTTATGTGGAGCTGACTTTGTGAAAAGTCAT
CAGAAACCTCCACAGG
gtatgtcgtactagcactgcaaaaatttgtttttaatgctctttgaagccaatctcactt
ataaactaaggtggtaaagtgagttaagaatcttgcagctattcctggctctgccacatt
tagacattgagaagtcttcccactctcagagccattgaaacatggtctgctctctctgcc
EXON 7  158 bp
ctttgcagtgaaagaatttgacctgtaaaaaccactaataaactatgtactatttaaaga
ttatacactatttaagattaagacattgatttttaggtggataattttaagagaaaattc
taaaactctttataataaattcttagactgaaatgcatgttaaattatcctgtgtgctag
GAATGGAAATTAAGTCCAATGAAAGATGCTGTTCTTTTGATGGAGATGCAGACAGAATTG
TTTATTACTACCATGATGCAGATGGCCACTTTCATCTCATAGATGGAGACAAGATAGCAA
CGTTAATTAGCAGTTTCCTTAAAGAGCTCCTGGTGGAG
gtatggtggggggattggctaccctctaaaacaagacttagtagtgaaatagttccatat
tttacaatcatttgtcagaagggcacaatttatgacaaattctttacattagtgggcaga
aaattaaaaaaagagcagtggtaatacccagtcatttgaacatttgaggcattggctttg
EXON 8  84 bp
tcaaatgtattttaggcttttttcctggcatacatgtaaattttcagtcagacatttttg
gcataaactaaggcacaactgaactggctgataattttggtagcctttagaactctcatt
atatttgtttttgtagaccatacttttgatggcaagttaagtatcattgtttttgtctag
ATTGGAGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACA
CGGTATCTTGAAGAAGTTATGAAG
gtattgaaccatttttgttttctggtagtttcttaattaagatcatgtttctgtgagaaa
gatactgccctcataaaagtgattatgttgtagtgcatgaagctgagctgctgttcatgt
aaaggtaaagagaaataaataagaaaaaatttagttgtccttgatgaataaaggaaaact
EXON 9  99 bp
ccagagtgtgttcatgcttccattgtatacgtaccattttgtattttaatgcttaatcgt
cttcctcactggactcggccccagtattttgttcccctttgtatctctgggatactaggt
atgcaagaaacatttgacatctgagtaattgctgtatttctttaaatgcatgtgttatag
GTACCTGTCTATTGCACTAAGACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTT
GACATTGGAGTTTATTTTGAAGCAAATGGGCATGGCACT
gtaagttctcttaattatagttggccttagctggcacttttctttatgatgagacttcta
tatctgggaggtaataataggtaatattgtactttgttgaaataattggatgtgacaaaa
agatcctttggttatcttatatattgatgtattatgaaactgtgattctcttttacatgg
EXON 10  114 bp
ctatcctctgggttttaatgtgatcttacattaatttcatacattttaaggctgccacta
tttttcccctcagtttctccagattgactaggagggaaaagtgggttagctagaataata
gtacttatgactaggttttggatagtgttttgagactgattttatattcttttgctgcag
GCACTGTTTAGTACAGCTGTTGAAATGAAGATAAAACAATCAGCAGAACAACTGGAAGAT
AAGAAAAGAAAAGCTGCTAAGATGCTTGAAAACATTATTGACTTGTTTAACCAG
gtcagaactgatggggcagtggactcttggttacctttacattattcagaagatggacag
aacagagtgtgggtgcatacaaaattaaagtggagacgtcctggcctggtggcttccttc
taatagtggtatattcagttgagatttataatgaaatggaatgacagaacattttttaat
EXON 11  123 bp
attttgacctgtcacaggaggccaggtgtggaatttttcacttgtgattattttggcact
cagcatgtttcagattcaggttgttcaacctgtactgtgattggttttctaagaaaaaac
atccatttccaagatttgcttgtgttaagtggtttcttccatttgtttccccatttgcag
GCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAAGCAATCTTGGCTCTGAAGGGC
TTGACTGTACAACAGTGGGATGCTCTCTATACAGATCTTCCAAACAGACAACTTAAAGTT
CAG
gtgtgagagaaactttaaagtaacttttttgaatattagctaagtaaaacctattatccc
aattctcattatatctcactgacatatgtttcctatttcattctgtacatacacatatga
tacatagaaaataaggccttatgggccaagcgcagtagctcgtggctcatgcctttaatc
EXON 12  174 bp
agactgaagaaaaagagaaaagttgcacaaatgttgaaattaattaccctgaccttggag
aaagaagttttaatgtaattttatatttagtctggcacttttcgtagaatgtatgtttaa
caggttaagcttctgaaaggaagtgtaatagagtaacaaatatgaaatgcttgcacttag
GTTGCAGACAGGAGAGTTATTAGCACTACCGATGCTGAAAGACAAGCAGTTACACCCCCA
GGATTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACAAGCTTTCTCGAGCTTTTGTC
CGGCCCTCTGGTACAGAAGATGTCGTCCGAGTATATGCAGAAGCAGACTCACAA
gtaagctgggatagttctattgaaaaagagcctaatattaggtgatgggcaggcaaacta
ttttaatggtttttagaatctcactatgatgattaaggctttattttgttgagcctttta
ggttcacattaagactacaaaattattttcaccagcagtaattatacaatttaacaaaat
EXON 13  413 bp
ttatttaagggctttggaatttgttactgaaagatgaaaaaaggttttcattagaatttg
ttagtgaaacaaaatcaagaatcacccctctcttccccagagttccaagtaacatggtct
tgcccatgttagacacatgctatgtctttctcatctaatctcttttaatgtaatttgcag
GAAAGTGCAGATCACCTTGCACATGAAGTGAGCTTGGCAGTATTTCAGCTGGCTGGAGGA
ATTGGAGAAAGGCCCCAACCAGGTTTCTGAAGATAATTTTCATATTCCTGAGAAACTGGA
CTTTTTACAAGTCTTTACAAAACTGTCAATAATAATGGCAGTACTAAGAGATTTATAATC
ATAATGTTTACAATGCAGCCTACTGGATTGTCTCTAGATCTGTTTTTCTTAAACACTAAC
AGAATAATTCTTTATAAATAGGTAAGCCTTACACTTGTTAAAGAAATTTACCTCTAATTT
CAGTCTCACTAATGTAAAATACTGGGACTTAAGTATACAATTCAGTCACTAACTGTACAG
TTTTATGTGGGGAACAATTCATGCAGGCTACTGGAAAATTAAATCTTATTACC
aactccttgtgatatctttgccatcaccatcacatgagcaagatgatgttttgcagcatt
ccccattgctgatacaaatggagagggcagagaagactttatacaaccagtttttccatt
gcagagtcttaagaaagattattagatgacttacctatatgactaatgccatcaggaact