Gene PEX7 Variant 1
DNA : 91.34 KbNT_025741
mRNA : 1448 bp NM_000288
CDS : 972 bp NP_000279
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  211 bp
ataatacctaaccctggatcactcccctgatagatctgtatctttgcagcaggcgcaatt
cagtttggattcacccaaaacaaaaatggtctccgtcggagtcaacgccctttcctgtgc
ggaccaatcagaatctcaaacacagggcacggggcccacacttccgtccggtctgcctgg
TCTCTCTAACCGCGCCAGTGTGCCTCCGACTCGGAACGGCTTCCGCGGCCGGGGCAGCGA
GGGCCGGGGGCGGCGGGCGGGATGAGTGCGGTGTGCGGTGGAGCGGCGCGGATGCTGCGG
ACGCCGGGACGCCACGGCTACGCCGCCGAGTTCTCCCCGTACCTGCCGGGCCGCCTGGCC
TGCGCCACCGCGCAGCACTACGGCATCGCGG
gtgaggcggcgccgcgcagctggggccggggggcggaggcggaggcgggggccagccggg
ctccagttcctcgcgctcgagggaaagcccctctgagcgtagacggttccgcgggtccac
gccagggggcagaagaggcgctggtcggcgcttctcctttctttgccgagtgcgaggagt
EXON 2  58 bp
tcatgtcccaaaaactttagggagaaattgatcacctgaccatttggtattcaaggtccc
aaatactttggggaaaaatttgtggtattaaaatcaggtatcaattacttgataactcct
tgactttcgatgttaccctggcaggttcaaagggatgaccttgattttttttctctttag
GCTGTGGAACCCTACTAATATTGGATCCAGATGAAGCTGGGCTAAGGCTTTTTAGAAG
gtaagggggctgaaattattaaaggtatatattgttgctattaaagccttaatagaatta
ggttttgactctttgattaatgttttaatatacagtataaaaggaaccttggcgtttgca
taggatgaagcttatttttagctgattgtggtggtgcgcacctgtagtcccagctattcc
EXON 3  151 bp
tgccatatttgtcaagtacctactctacttaactcccgtagttgtgcagattacatgaga
tatacgtgttaaaatgtgtgataaattgaaagaaaaaaaaccataattgttatttttttt
gttgtgtagctgcctatgtaagtgttgtatttttttgttgtttgttttttcctagtgtag
CTTTGACTGGAATGATGGTTTGTTTGATGTGACTTGGAGTGAGAACAACGAACATGTCCT
CATCACCTGTAGTGGCGATGGCTCGCTGCAGCTCTGGGACACTGCCAAAGCTGCAGGGCC
ACTGCAAGTCTATAAAGAACACGCTCAGGAG
gtaggagggaaatctttctgggctgattatttttctttcttcgactttggttgaaatcca
tttggggatggacacatggagaaatatcttcaggggacaagtttaaacgttagcatttct
tatacatactagatgtcacttattatttgattattcaaacataaagtacctcttggccta
EXON 4  78 bp
gaggaatggacaagatcaacttttcatttctcagacaccttgttgagatggataggaatt
atttgatgttttgacatagtaaattagttgttctgcctctcattgttatgtaacaagaga
taaaatgcaatgttgaacttgatggtcttttgctttctaaacacttttcaatgtttttag
GTGTATAGTGTTGATTGGAGCCAAACCAGAGGTGAACAGCTTGTGGTGTCTGGCTCATGG
GATCAAACTGTCAAATTG
gtatgttagcattattgtattcaaaaacgaatattcccttctctagagcttccactaaat
tttcttctctttttccaacatacttctgtagctctatgattcgacagctgagctttcttt
taaaaaaaaaattaaaacacttattagaacttaaaattttctaatcttttggctgtgaac
EXON 5  109 bp
gtttggcccttaaatacagtcttgctttatatcaaaacagatctttaaaaatccttgaga
tctgtatatatattgtatgcatatatataaatgtatatagtttattggtgtatgtagtat
atgtaaaagcataaatttgaatttatccctcaagtaattgatctattcatttatttgtag
TGGGATCCAACTGTTGGAAAGTCTCTGTGCACCTTTAGAGGCCATGAAAGTATTATTTAT
AGCACAATCTGGTCTCCCCACATCCCTGGTTGTTTTGCTTCAGCCTCAG
gtaaattattctgtatttaccaaaagccttacttgtagtgaatggtggccttgtttttac
cattaggtggcgctgtgtaccttagcttcagagagaaaacaggagaatattactattctt
ttgtgttcttaagactttacttctttttttatttttatttttttatttttattattatac
EXON 6  107 bp
tgtattccttcatttgaatagttcctatacattattatggtttaaaaaataagtctgaag
gtggcaatatcctaacactgaaagcagtgtatttttacttgacttattattgtgaacaca
ttatgtcactgcacattcaagtggtgtgatgggaaatgatcaagtcttcctttttactag
GTGATCAGACTCTGAGAATATGGGATGTGAAGGCAGCAGGAGTAAGAATCGTGATTCCTG
CACATCAGGCAGAAATCTTGAGTTGTGACTGGTGTAAATACAATGAG
gtatagtgtatggctctatcctatgctgctgtccttcctaatgttaaaatgttctgaatt
ttatttgtctttgtttatgtggactttggtggtgttcctggaccattaagttaaattctg
tccctttcctttctaattaatgattgtgactgacctgcattagcattaattggatttaag
EXON 7  114 bp
ttttttgctattaatgtctatgttgattcctgtctatacttgttatacaacttctcaaaa
atgactccttggttcatattaaatagttatcagaaagcagatgttgtttctagtaggaaa
gcctgcatactgtttaattgcaaagatgtcacagtttatgtttctctgaattgtttttag
AATTTGCTGGTGACCGGGGCGGTTGACTGTAGTTTGAGAGGCTGGGACTTAAGGAATGTA
CGACAACCAGTGTTTGAACTTCTTGGTCATACCTATGCTATTAGGAGGGTGAAA
gtaagttttcatcttttcttttatatgtagaataaaattatataaatataatcaatgaag
tgtatattaaaaagtgttctgggtttagggattggagttactaattcttttttatatgtg
tttttgttacccaattaattagtagtgaaagctaaaattaggcaaaaatatttgaataat
EXON 8  56 bp
ataaggccagaagatttttgcctcaaattatagcatatatgctttgaaaaagcataattt
taagtgacagctctgactcaacttaaatttattataatgtttatggaatgatcatagaaa
gcagtgttataatcacagctgacttcaaaaagggttttttttttctttttttttttgtag
TTTTCACCATTTCATGCTTCTGTGCTGGCCTCTTGCTCGTATGATTTTACTGTAAG
gtacagtggtttttaatacatttcattgtgaaataccaggtaacatttgcatctttgcaa
cttttataagagataatatgattactcttactaacatgaaaataatctgagatgggtaca
tttaaatatttactaggattaatattatatttttcctgttttcgtgatccagtcacatat
EXON 9  100 bp
ggagtacttttttttcttattggattttttacgtagggcttaatagtggggttctgtatt
tatgaattggctgagcctgtttggataaaatctttgctatgtcaaatatctattttttct
taatataagttttttggtagttttagcatttaaattattcccttttatttatcttcacag
ATTCTGGAACTTTTCAAAGCCTGACTCTCTTCTTGAAACAGTGGAGCATCATACAGAGTT
TACTTGTGGTTTAGACTTCAGTCTTCAGAGCCCCACTCAG
gtaacggatacaatctcatgatattctcttctgcccaagttcacagccaactctgtgtgg
catgcattgcttttatgaataaaattgttgccattttagctatataagctggagcgtttg
agcattaaactactagggaataagaggtatcaagaaagttgacatacctttctcctcttg
EXON 10  464 bp
tatatcctaaaaagggaatatggaccttttatcaaaaacgtagccctatgttttccctat
tcaaaaatatgtttactagtggatgatttacgacactctaaatgacttgagtttttgctg
tcaattttgaatttttgtatgtctaaatacgtttcttcttacttcatttttgttttctag
GTGGCTGACTGTTCTTGGGATGAAACAATAAAGATCTATGACCCTGCTTGTCTTACTATT
CCTGCTTGAGATACACTACTTTGGTCAGAAACAGAGGATGTTGGCTGAAGAACTGCCTAA
CAGCAAATAAATTAACTATGGAAAACATAGACATTATGCTTTTATATGCTATTCAGATTT
CAAATCTTTCCAATTTACCCTGGAATCAGTTTTGAGGGAGCTGATAAAGACTTTAGCTGA
CTCGTTAAGCCTGATACATAAGCCATATTTAAAATTCTAAGAAATAATTAATGTTATGAT
ATATCTTGTAGTATCTATTAAAATGTCTCTGGGTCATAAAATGGATTAAAATATGGGAGA
TCAGTAGGTTATACTTATATAGATAGTGATATATTTCATTTTTAATTTGTCATTTTTGAT
GTAAAATATAATCACTGCTGTGATAAATAAACTATCTATTGATC
atttatcattttataacttcccccaaaagactgctctttctaatacattgtatatgtgaa
tatagtactatatataatatagatatatctgtggttcagtaacaggacactagaatatat
ttaatttattcttttatttagtagctgtttattgagcatctactcagtgcttgacacata