Gene NEU1 Variant 1
DNA : 3.70 KbNT_007592
mRNA : 1894 bp NM_000434
CDS : 1248 bp NP_000425
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  289 bp
caaaaagcccaataaggatggtgccagtcccttcttcaccccagccagtccgcttcccgt
tcgggtcacgcgctccgggcctccaagagggcctccaagagggccaatcggaagggcaag
cttcgagatgctgcgtgatcacgtgggaggagatgagctacttgaagaccaattagagtc
CGGGAAGCGCGGCGGGGCCTCCAGACCGGGGCGGGCTTAAGGGTGACATCTGCGCTTTAA
AGGGTCCGGGTCAGCTGACTCCCGACTCTGTGGAGTCTAGCTGCCAGGGTCGCGGCAGCT
GCGGGGAGAGATGACTGGGGAGCGACCCAGCACGGCGCTCCCGGACAGACGCTGGGGGCC
GCGGATTCTGGGCTTCTGGGGAGGCTGTAGGGTTTGGGTGTTTGCCGCGATCTTCCTGCT
GCTGTCTCTGGCAGCCTCCTGGTCCAAGGCTGAGAACGACTTCGGTCTG
gtgagtcaccctttgcatagccccatccccgacccgcgcaggtgatcgacacctagtgtc
ccccggaacgcgggcggctgagccgactttccgcgacaggacccttttctttctcccaga
ccccgtttcctcctaccgctcccagcccctctccctctccgggtccccgtccttctcctc
EXON 2  193 bp
ctcccctgctccgagcctccagcttcgctccaaactccccttcgtgttcctctttcttgt
tctgggaccccatcccctactcgggatccccattagatcctccctctcccatcggaacgt
gggttcctaaaacccccaagacaagtttgtctttgttgacccttcctcctcccatgacag
GTGCAGCCGCTGGTGACCATGGAGCAACTGCTGTGGGTGAGCGGGAGACAGATCGGCTCA
GTGGACACCTTCCGCATCCCGCTCATCACAGCCACTCCGCGGGGCACTCTTCTCGCCTTT
GCTGAGGCGAGGAAAATGTCCTCATCCGATGAGGGGGCCAAGTTCATCGCCCTGCGGAGG
TCCATGGACCAGG
gtataaagatgtctgggtgaaagagccggtgctaggttggatgggtgggcagcccaatga
gcccaagggccctgaggataggggaacttagagggttggttgcctgagtccctgaggggt
agagggaacccgagaagggcaagtgtctaggacagtgatctggaaattgggatcaccaag
EXON 3  263 bp
taaatgcaatggagaaaaataaaacaggacaagaggtatagatagtgcaagtgttggatt
gcaccctgggaccatcggaaggcctgaggtccctagcagaaggtgggaaattaacgggaa
gtggtagaaagggtacctgcagagtgctcactctgggtttcttcctccaatttttttcag
GCAGCACATGGTCTCCTACAGCGTTCATTGTCAATGATGGGGATGTCCCCGATGGGCTGA
ACCTTGGGGCAGTAGTGAGCGATGTTGAGACAGGAGTAGTATTTCTTTTCTACTCCCTTT
GTGCTCACAAGGCCGGCTGCCAGGTGGCCTCTACCATGTTGGTATGGAGCAAGGATGATG
GTGTTTCCTGGAGCACACCCCGGAATCTCTCCCTGGATATTGGCACTGAAGTGTTTGCCC
CTGGACCGGGCTCTGGTATTCAG
gtctctgtcctaggagataggtggagggggctgccttgtggagagtctgagggatacccc
caaatggactcctttccaaggggaagattctctgaagtcagattttctggcttgggtggg
attccttgaaagacagggcatcctggtaggaacacattatcaggagaagagggaactctg
EXON 4  183 bp
gagagcttcttaattcaaacagggtgtgtatttatgggatctgactggaaccctcagtga
gcaagggctgaactcaaggggaccatacatgtgattgcatttgggaagtggtgggttctc
tgtccctgcctctgagcccctagagtctccttctgtgacacccagttccctttcccacag
AAACAGCGGGAGCCACGGAAGGGCCGCCTCATCGTGTGTGGCCATGGGACGCTGGAGCGG
GACGGAGTCTTCTGTCTCCTCAGCGATGATCATGGTGCCTCCTGGCGCTACGGAAGTGGG
GTCAGCGGCATCCCCTACGGTCAGCCCAAGCAGGAAAATGATTTCAATCCTGATGAATGC
CAG
gtcaggagtccatgagatgttccctacccatttgaccctccctgccctccagaacatcat
ttcacgcacagacccagggtctgactgctccactcagtgccacacacccttgctcccctc
ggggacagggcattttccctgttccctccctgaggtcctgtcctctcccctcagccctat
EXON 5  223 bp
tgccaggtcaggagtccatgagatgttccctacccatttgaccctccctgccctccagaa
catcatttcacgcacagacccagggtctgactgctccactcagtgccacacacccttgct
cccctcggggacagggcattttccctgttccctccctgaggtcctgtcctctcccctcag
CCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCAC
TGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGAT
GTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGC
TCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCC
gtgagtgcctcatgggtggggtcagcagggagagccctgtgtctagacaaggcctgggca
gagaccctctctccctgactctcctgctctccccaggagtgaacctgaccctgcgatgga
gcttcagcaatggtacctcatggcggaaagagacagtccagctatggccaggccccagtg
EXON 6  743 bp
tcgtggaccctgtggtagctgcaggagctgtagtcaccagctccggcattgtcttcttct
ccaacccagcacatccagagttccgtgagtgcctcatgggtggggtcagcagggagagcc
ctgtgtctagacaaggcctgggcagagaccctctctccctgactctcctgctctccccag
GAGTGAACCTGACCCTGCGATGGAGCTTCAGCAATGGTACCTCATGGCGGAAAGAGACAG
TCCAGCTATGGCCAGGCCCCAGTGGCTATTCATCCCTGGCAACCCTGGAGGGCAGCATGG
ATGGAGAGGAGCAGGCCCCCCAGCTCTACGTCCTGTATGAGAAAGGCCGGAACCACTACA
CAGAGAGCATCTCCGTGGCCAAAATCAGTGTCTATGGGACACTCTGAGCTGTGCCACTGC
CACAGGGGTATTCTGCCTTCAGGACTCTGCCTTCAGGAACACGGGTCTGTAGAGGGTCTG
CTGGAGACGCCTGAAAGACAGTTCCATCTTCCTTTAGACTCCAGCCTTGGCAAAATCACC
TTCCCTTTACCAGGGAAATCACTTCCTTTAGGACTGAAAGCTAGGCGTCCTCTCCCACAA
AAAAGTCCTGCCCTCATCTGAGAATACTGTCTTTCCATATGGCTAAGTGTGGCCCCACCA
CCCTCTCTGCCCTCCCGGGACATTGATTGGTCCTGTCTTGGGCAGGTCTAGTGAGCTGTA
GAATTGAATCAATGTGAACTCAGGGAACTGGGGAAGGCTGAGCCTCCTCTTTGGTGTTGC
GGTAAGATAACCGACAGGGCTGGTGAAAGTCCCCAGATGGCAGGATATTTGGTTTCAGAG
TAAGGACTAGGTGCACCACCATGACTGACTATCAATCAAAATGTTTGTAACTTAAAATTT
TTAATGAAGGATAATGAATATTT
gtagagtctctatggttctgtcaatgcacatcttcgtgtctgttttcctcatgtatcctt
gtgagcctgggtgagttctggggagagacctgatgtgcgtactgcctgtgaaaatctgac
tttggcaaatcaaatcctcttttccttttgacatgccctctttttttgttgttgcttttt