Gene MYB Variant 1
DNA : 37.75 KbNT_025741
mRNA : 3204 bp NM_005375
CDS : 1923 bp NP_005366
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
cgccagatttggcgggagggggagtgtccaaagctctttgtttgatggcatctctgttta
cagagtttacactttaatatcaacctgtttcctcctcctccttctcctcctcctccgtga
cctcctcctcctctttctcctgagaaacttcgccccagcggtgcggagcgccgctgcgca
GCCGGGGAGGGACGCAGGCAGGCGGCGGGCAGCGGGAGGCGGCAGCCCGGTGCGGTCCCC
GCGGCTCTCGGCGGAGCCCCGCGCCCGCCGCGCCATGGCCCGAAGACCCCGGCACAG
gtaacggggagccgggcgggcggccgagggcgggggcgcgcgggggcgcgcggggcgcca
ggctcccgggagcaggtgggaattcgttccgggatcatctgaggggctgtcagaccctcc
gaggacctggagcccctgcctcggcagcagaagccgctccagagactgatgaatggaaga
EXON 2  118 bp
aaccagtttacaatactagagcaacagaatgcagcaaacaatcttgttgtgcaagttttc
aaagttttgtcttcataacctttgaaaagattgttgaggagttttgtgtaagttttgtaa
tccagtagtagtctaaatcctcttgtttcagcccacgtctacccattcttatttctgcag
CATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATGTGTGACCATGACTATGATGG
GCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGGTGGACCCGGGAAGAG
gtaactaatcattttatcaagacgcagaaaatagatagagtgtataatttataaaaaaca
aaatttcaactaaactacaggtgctcaagctcattagcaggctccttgagatcttatcct
agcccgcatgtgcagcgtgccctatgccccccacttcattatattatccatttccacact
EXON 3  72 bp
aactctggtctgattctaaataaatctatactcccaagtccgtatattacattaatatct
cctgtattcggatactttagagagactttttattctagattcgttccctcattcacttta
acttgaacagagttatatagtaaataactgatatcctaggattacctttaaatgtcttag
GATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGGAAAGTTATTGCC
AATTATCTCCCG
gtaagttagtaagtttttcttataacgaaaggaaagcttctcccaaagatttctataaaa
tattctaggaggagttattaagatagtgtataatttactcacatttaagaagtgggagaa
atgccctacccataacttatattttatattataatgcatataattaaattattagaattt
EXON 4  93 bp
tatattacttgcatgttctgtagcctgtaagtaatgagggatagatgggctctaaacatg
ctctaaaatgttcttaaatattttcactgcatatggtctatgtgtgattcctattacaac
aaaaaattcacgtgcttatcacatcatatctttatggtggtgcatactttatttgtctag
AATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAAGTACTAAACCCTGAGCTCATC
AAGGGTCCTTGGACCAAAGAAGAAGATCAGAGA
gtaagttctttcttcattggtgtgtgactcataattaagaatattcccaaaatgctaata
ttttcctatttgaggaagcaggtaaaatgggcaaacaggaagtagaggactctattccca
tatttccagtgaatgaaagcaaattttggaaattttctaaagatcttgtaacactgaaga
EXON 5  221 bp
tcctatttgaggaagcaggtaaaatgggcaaacaggaagtagaggactctattcccatat
ttccagtgaatgaaagcaaattttggaaattttctaaagatcttgtaacactgaagaatg
attatactgactcattacataactttaaaacataggttatttttgtgtgtttatctgaag
GTGATAGAGCTTGTACAGAAATACGGTCCGAAACGTTGGTCTGTTATTGCCAAGCACTTA
AAGGGGAGAATTGGAAAACAATGTAGGGAGAGGTGGCATAACCACTTGAATCCAGAAGTT
AAGAAAACCTCCTGGACAGAAGAGGAAGACAGAATTATTTACCAGGCACACAAGAGACTG
GGGAACAGATGGGCAGAAATCGCAAAGCTACTGCCTGGACG
gtaataatatgtcaaaaaatatattgatcgggaagaatgagggagtgggtattgaacatt
ctgctttaaatgtatggtgagtaaattatatttcatcagtcgtaagtgttttattagata
aaccagctacatagcttttagagattgaagacatcttagagtttatttggttgagaactt
EXON 6  235 bp
ctaactaggcaatagagaaagcctgatctcagagggtggagaagaaggaaacaattaaaa
agagaaaacaactaataggcccaagggaaaggtctctgttagaaacagttttctgtcaat
tcactttaatctgaattgaaatttttgtttgtgaaatttgtgtgatatatttctgtgcag
AACTGATAATGCTATCAAGAACCACTGGAATTCTACAATGCGTCGGAAGGTCGAACAGGA
AGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTGGCCACAAGCTTCCAGAA
GAACAGTCATTTGATGGGTTTTGCTCAGGCTCCGCCTACAGCTCAACTCCCTGCCACTGG
CCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCACAAAAT
gtaagccattcctgtgaatctagtttaatgagagagacggttagtttagctccaggtaat
aatcatactttgcagttgtatacttttcagagaactttcctgagcatgatcatggccagt
cttcacctatgccctttgaagtagatagggtgtaggtatggtgtgttacccctggtttat
EXON 7  81 bp
tagccattttaaaggcctggctaaatttcacattaaaaggttttaaaaatttgtttagtg
tattttatcagtaaagtgttttttttctctcagtcccagaacgaaacctcaggaagccaa
gtcccctgaagcatatgtagccctgaatgacgtggcctttgttttgtcttttgcatctag
GTCTCCAGTCATGTTCCATACCCTGTAGCGTTACATGTAAATATAGTCAATGTCCCTCAG
CCAGCTGCCGCAGCCATTCAG
gtaagatcattgatcattcactgttcaaagcaccacttttaagaaatgcttatttctttc
atctaaacacatatttttacctgagcaactaaagtaaaaaggaaagggaacatggagagg
agagcagagtcttggccagcaatctattaatcttgtcttctagaatgagtttgctctgga
EXON 8  105 bp
tcccttaagtctgaaataacattcacaaagatttctgcaggagccaaatttggttggtgg
tgttgtcacagtgaggctctttgggctgtgcggcacctcatgaccatattggctacaccc
attgtatttgcagcttccaatcagacctttgtctttatttcccttactttgtaatttcag
AGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGAATAAAGGAATTAGAATTGCTC
CTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTACCA
gtaagactgtcatcatgtgcttgaatgaggggatagcagctttgcctcagtttacctaag
cgctcttctcttctaaatattacacttagcaaggctccatatatccattcagaatgtctc
aacacaagaagttgcttgtagtaaaatgtagttggtatcagattatatgctgattaaatt
EXON 9  255 bp
ggtcttgcattgataaaaggaaacatcttgacaactgtttcataggcgtaagtttgggat
gatgcaactactcttatctttcctccaacagcatctgataccttgtgcaacttcattgct
aagttccttctccctttcttctgtcctctctttatttctacacccttcccccttccttag
ACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCT
CTGCCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATC
GTCCACCAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTC
CAATTTATAGATTCT
gtaagtagaattgtgaagggaagttaacgattctggaagataaattagaaaacccatttc
ttaaatcattgccattttctatagccaagctgttattagcatatattaatgtaaaggtag
aagtatgattttcatcttcatgaatatgttttttcaaagatctgatttcatagcctaccg
EXON 10  143 bp
cctgggtgctcaattgaaataaaacaataccctagtcaatataacatgcttgttagcatc
tttattatttaatatagtgggtcaggaaaacattcttgttatctaggtgtgatttttaaa
ttggggagaataaagaattaccatctaatctaagtattttttctttctctccatatttag
TTCTTAAACACTTCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACTTCC
ACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
AAAACTCAAAAGGAAAATACTGT
gtaagtctttggttcaggaataaaatgatttatcttatttacttatatttaattaatgga
atatagttcccagatgtctgatccacttgtatgtgcataattttactgaccatttatata
taatcatgtctattcccacattgaatatatctgtcctgggcatattacaactacctacag
EXON 11  115 bp
aatatgtgatatgcatattctctttttcttaacgaataacgtgattaatcagcacacccc
aattccatatccggaacagagtttattgtattcagtggaaaaatgttaaatgtaacaggt
aaagccatgtagggacatttattcttttgtattgagccactgcttgttttctttttaaag
TTTTAGAACCCCAGCTATCAAAAGGTCAATCTTAGAAAGCTCTCCAAGAACTCCTACACC
ATTCAAACATGCACTTGCAGCTCAAGAAATTAAATACGGTCCCCTGAAGATGCTA
gtaagttctagaaaagtttttggatttcattggtttattagtcccattaggagttctctc
tgatgcaaaaatacccactcttccgtttagcctcagacaccctctcatctagtagaagat
ctgcaggatgtgatcaaacaggaatctgatgaatctggaattgttgctgagtttcaagaa
EXON 12  126 bp
tcaatcttagaaagctctccaagaactcctacaccattcaaacatgcacttgcagctcaa
gaaattaaatacggtcccctgaagatgctagtaagttctagaaaagtttttggatttcat
tggtttattagtcccattaggagttctctctgatgcaaaaatacccactcttccgtttag
CCTCAGACACCCTCTCATCTAGTAGAAGATCTGCAGGATGTGATCAAACAGGAATCTGAT
GAATCTGGAATTGTTGCTGAGTTTCAAGAAAATGGACCACCCTTACTGAAGAAAATCAAA
CAAGAG
gtaaacacgcaaccctttggaagcaacaagctgagaatcctgccccctttattccttgtg
tgcagcttgatgtgtctgccattggcactgtgcaacaccacgacttttcgtgcaagattt
tcatacaaggtgcagcgaaaaggtactgccagactgtaggcatcatcaacctttcctttg
EXON 13  111 bp
caaatttgccatcagtgtttctttgttgaatccagaagatagagcaaattgagctgatag
tgtaagttagcaacatagttttataaaagtatttgagggactggccagaaatatactcct
gactgtacatgtttcataggaagttctagaaacaacaaagcactttctatatgcttttag
GTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGGGAAGGGGAC
AGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGGCAGATGCACCG
gtaagtacgtgtgcaccagcccccaagttgttatgtgacactggtgcctcatgaaatcct
gtgtgtggcatagggctgctgcggtttcagcactccctctttaacacatcttatttctaa
atgttctcctgcacatgatttttaaaaaatgattattaatgtagagtataaagttgagat
EXON 14  108 bp
gttcagacatagttgatttctccttttagctcatagtggggagaatttctggcagatgac
tgcatttttttatgctaatgtgtatcatctcatagtaatctactctccacagtgttagaa
aaatgtggctctcatattatccaacctcatttaaatttcaaattattctcttccctttag
AATATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTC
AAAGCATTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAG
gtaattactattccaacattggtattttaaaattcattcactgaaaaactgtcatctttg
gtggtggtggtggtggtggtgatggtagtgctggtggtctgtttttcgttttcaacattt
tagacataggggagtaatgcttttatacaattcttgatgtctagaaaaatccaataattc
EXON 15  1304 bp
tctgatcatccatatcccttaagaacaccggatttctgggggccagggaggtaagattct
atctgacaaagccttcctggtgtcaaccacttgccatctgttggtcagtgctggccctgc
tgggtctatagaatgagcttctttgtctgacgctcctgttgccatccctttctccatcag
CCTTGTAGCAGTACCTGGGAACCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCT
TCCAGTCAAGCTCGTAAATACGTGAATGCATTCTCAGCCCGGACGCTGGTCATGTGAGAC
ATTTCCAGAAAAGCATTATGGTTTTCAGAACACTTCAAGTTGACTTGGGATATATCATTC
CTCAACATGAAACTTTTCATGAATGGGAGAAGAACCTATTTTTGTTGTGGTACAACAGTT
GAGAGCAGCACCAAGTGCATTTAGTTGAATGAAGTCTTCTTGGATTTCACCCAACTAAAA
GGATTTTTAAAAATAAATAACAGTCTTACCTAAATTATTAGGTAATGAATTGTAGCCAGT
TGTTAATATCTTAATGCAGATTTTTTTAAAAAAAACATAAAATGATTTATCTGTATTTTA
AAGGATCCAACAGATCAGTATTTTTTCCTGTGATGGGTTTTTTGAAATTTGACACATTAA
AAGGTACTCCAGTATTTCACTTTTCTCGATCACTAAACATATGCATATATTTTTAAAAAT
CAGTAAAAGCATTACTCTAAGTGTAGACTTAATACCATGTGACATTTAATCCAGATTGTA
AATGCTCATTTATGGTTAATGACATTGAAGGTACATTTATTGTACCAAACCATTTTATGA
GTTTTCTGTTAGCTTGCTTTAAAAATTATTACTGTAAGAAATAGTTTTATAAAAAATTAT
ATTTTTATTCAGTAATTTAATTTTGTAAATGCCAAATGAAAAACGTTTTTTGCTGCTATG
GTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAAGAA
AAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATA
TATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCA
TTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTT
TTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTA
TAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAG
AACTGTTGCATGGATCCTGTGTTTGCAACTGGGGAGACAGAAACTGTGGTTGATAGCCAG
TCACTGCCTTAAGAACATTTGATGCAAGATGGCCAGCACTGAACTTTTGAGATATGACGG
TGTACTTACTGCCTTGTAGCAAAATAAAGATGTGCCCTTATTTT
acctacttttgttttctctcttatttgtcactatggacaacagttacactttaaagaaaa
tggagcagactcaaggcactttcctctaataattgcacaccatatgcacttcgtgtgaag
aagccaggaatcattacaatggaaaagaaagaacaagcaaactgagttaaatagttcaca