Gene ICK Variant 3
DNA : 45.62 KbNT_007592
mRNA : 1776 bp NM_173041
CDS : 879 bp NP_766629
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  239 bp
ccctagctaatttgaagcctcgttgcggggcacgttgaggacttgctttcggaatttccc
tgactaggcccttggctgtcccacaaggggtctgagcaaaaatcctcgagtacttatttg
caaccattttttactggatttctttctgttctgatttctttcttactaatctgagtagct
GTTATGAGAAGGATATTGACGGATATTCCAGAACAACTGATTCTTTTGTAATGTTAACCT
TTTAAAGTTTGACTTTGACACTAACATTAAGGACTTATATGTAATATAGCTAATGCATCA
TTCTGCAGAGAAGAGTATTCCTTTCCACTTACAACTAAATAAGACCTGCTTTTGCTGGAG
CTGTGCTAGGCTGAGGGAATTCCACACTGAATTTTACAAGCGGGATGGATTTCTCTAAG
gtatgggcgcttgtggggtttgaatttttttgtttgtttgtttggccggtagaactcttt
gtagtaacagaagtttgatagttacagttttcatttctcacatttcccagtgagtggagt
ttcagggtgtgcttcaatagtgaatggcaccattgccgaatataaagtttaaatgagctt
EXON 2  273 bp
ttgggctttgcaggctctacagcgtcacacaactattcagctctgctgttgtagtcatga
atggtatgcaagtatgtgggtatgactgtgttccaataaaacacagatttagacttacaa
aaacacgtatactcaaaatgtatattaacatttatccttgtctctcatttttctctgcag
GCAGAAGACTGATTTTTGGAAATATGTATTTGGGAGACAGTCACGTCCTATTGAATACCT
TGTGCTGGTGCTGCCATCGAAAAATCTGGTTACACTCTGGGGAGGACTGCTACCACTGCA
GAACTGAACCACTTCGGCCGTGAGATGAGTGTCCGGCCTGAGCAGGCACACCATGAATAG
ATACACAACAATCAGGCAGCTCGGGGATGGAACCTACGGTTCCGTCCTGCTGGGAAGAAG
CATTGAGTCTGGGGAGCTGATCGCTATTAAAAA
gtaagtttgatccttcactgccatgataattttaactctaccctcaccattacccgtctt
tgtaacagttctaaaggggagtgggtaggatgcctagagaagaaccttagataatgattg
ctgtgggttagatgattattgactctgtaacactcatgttagaggtctgaaaacatttcc
EXON 3  55 bp
aggattattgcactgctgtttgaaaataagtgctggtttgggatagtataatactgggta
gaaatttaaacccactttaagtactgttaattaggatcagaatggaagcatttttctaaa
agcaaagtttaacctattactgagaataagtgtgctgtttgtttctttcttctcttctag
AATGAAAAGAAAATTTTATTCCTGGGAGGAATGCATGAACCTTCGGGAGGTTAAG
gtatatattaatataccaaggaataatttatggatgattaaaatagctttgtacatgctt
agatttatagttgatatagtcatttcatttgaattttttcactaatgctggaaagggagg
caaatgataacattacagctgaagcagaagattatggtataattgtatatactgttatta
EXON 4  122 bp
taaagttattataaatttcagaggtatactattaaactgtcaataaaatataatttagca
catttctgaggttctaaaattagttgtttctttccaagtatacataggattacttttctt
tttcaacaacagattttctctaatatttgttttgttttgtgtttattccttgccttttag
TCTTTAAAGAAGCTCAACCATGCCAATGTAGTCAAATTAAAAGAAGTTATCAGGGAAAAT
GATCATCTTTATTTTATCTTCGAGTACATGAAGGAAAATCTTTACCAGCTCATTAAAGAG
AG
gtacagtttggtcatcattatcttattatagaaataaataggcaaagcagatgtgttttc
tttctgcttttgtgttttctttctctcctttttttctttttttattttttattttttatt
ttattttattattattatactttaagttttagggtacatgtgcacaatgtgtaggttagt
EXON 5  80 bp
ggaggaaaaacttttttttggcttactatcaaatgtttaatctttttgtttttgtaacat
gtgactatatttggtgtttataaggtagctcccctgtatggacaaatggtattctttagt
atttattatcaaaggatctggcctttgatttataactttgttttcctctgcctcatacag
AAATAAGTTGTTTCCTGAGTCTGCTATAAGGAATATCATGTATCAGATATTACAAGGACT
CGCATTTATTCACAAACACG
gtaggtgattcggagtgttgtgcttttgaagagcagtgaaatgttgttatcaagtagaag
ttgtaggaaacattaatattttttgtagctgactcccagaaaaggttgaagagttgagag
gctgacaatggattttaaaatatattaacttttataacttgatctctgaatttccctcat
EXON 6  133 bp
agtaatcctatgagaagttcgaaggactctacattatctgtgggatgaatgcataaagcc
tttggtgccatgccagactactttttaaattataactattttgcagagagcaatacaatt
gcaaagaataatacgaagcaaacttgcatttggatttcttctcctctactgtctctatag
GCTTCTTTCATCGAGACTTAAAGCCTGAGAACCTCCTCTGCATGGGACCAGAACTTGTGA
AAATTGCAGACTTTGGTTTGGCCCGAGAAATACGATCAAAACCTCCATATACAGATTATG
TATCTACCAGATG
gtgaataccatttttctcaaaattatttaattgcacttctttaaaaagatatcattatgc
taaggataatattaaagtcacaaatgttaacttttcactaagagaaacagtgcagtctga
aacatatatttatagatatgttggtaatgtacaaggttaaaaatcttgtgttctaaatca
EXON 7  172 bp
gaagcactacttgtcaacagcagcccacggcagttgccaagttctcacaattccattaca
ccacagtgaactagagagaaaataggaacatatacaccccctcactgagaactgattgtt
atttaatttaatgtctgagtggtggaagcaatagctagcagttaacctttgttcctccag
GTACAGGGCTCCAGAAGTACTCCTGAGGTCTACCAACTACAGCTCCCCCATTGACGTCTG
GGCGGTGGGCTGCATCATGGCAGAAGTTTACACCCTCAGGCCACTCTTCCCTGGAGCCAG
TGAAATTGACACAATATTCAAAATTTGCCAAGTGCTGGGGACACCAAAAAAG
gtaatgatacaaaacaaaggccagtgggccaaagccaacagcttcccatgcttcctccgc
tcagccctgttcagcactggcatgattgagcacctgcccattctaggctctttctcttga
cctcagtcattctccactgcccacgttctcagatacggtcggcttctcttcctcctcctg
EXON 8  702 bp
ctctattaatctaaatctatgtctcattccatacagtgccacagtagtgaatgtgggtgg
ttaatgaatgtgggtgggtaatgacatggttgcctttccatttggggcacacatgccaga
atacaaacttatatcacagcaattggctgagcaagattttctatcttttccttctttcag
ACTGACTGGCCTGAAGGCTATCAACTTTCAAGTGCAATGAACTTCCGTTGGCCACAGTGT
GTACCCAATAACTTAAAGACCTTGATTCCCAATGCTAGCAGTGAAGCAGTCCAGCTCCTG
AGAGACATGCTTCAGTGGGATCCCAAGAAACGACCAACAGCTAGTCAGGTTTTCTTCCAT
TTTCTTGTTATAACGTTCATATCTAACTCTGAATAATTTCTATGAATTGCACAGGAAATA
TTTAGTATTTAGTATTATGGGTGAGAAATAGTACAGAATACCACTAATGGTGTACTATAT
AAGGTATGAGAACTTAAAATAGTTTGAAACTTACTGGGTATAAAGTAGTTACAATGTAAA
CAATATAGTTGCTTTGAAAATTGGCATGTAATTCACATGATATATCACCATTTATATGGA
AATGGAAATAAACATATATTTATCTGTCTTTGGAGAATGTTTTCAAATCTATTCTCTATG
AGTTACAATTATATAGTAGTTTGTTTATAAGCCGGTACTGGTTGTTGAAAGGCAACTTCA
TATTATGTAAAAGTCCAACTGACTCATAACCTGAAGAGATTGACAGATGAGATAGACCTA
GGATAGTAACTGCACTTAGTATTTCATAGCACTTTACAGTGTGCAAATGCTTGAATATAT
TTTATATGATTTTTAATCCAATAAAGACTCCATGAGACAGGC
attattgttttcaattctgtgagtgagaaaactcaatcttggaaagtttaagcaatttgc
tctaatcactcatccattaattagttcaaatagtgcaactaactacaattcaaccaactg
accggaagtatgaagtcaggtccactggtttcatagctcctttcccaatccatcctccca