Gene ICK Variant 1
DNA : 60.47 KbNT_007592
mRNA : 6095 bp NM_014920
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  175 bp
cggccgcgcgagccagggcgaacaggacgcagtgcagggacgcgcagggccagcgagggg
agctgcagggtaacttttcccagggaaagcggccggtcgtccccagtagaagccacccag
ccttttgtttgttttcctgccggaggctggaaaacggccgggttcctgctgcactaccat
GCGCCGTGCGGCCCGTGCGACTCGCCGGACCTCGCGGGCGTCCCTGTACGGAGCCCTCGG
CCGGTCCTAGCAGGGATTGTCCCCATTTCCAGCTCCGGAGCGGGCGGCTGCGCCCCGCTC
GTCGAGGAGCTGCGCTCACCTCAGGGGCGGGCCCCCGCCTGCGTTCGCGGCGCCA
gtaagtggggctccgggatttaggggcttctgccgggcgacctgtcactgtagtagctgc
tgggatggggcggcggggagacccctggccgtggccccgcgacggatcggaggcgcagga
agaggctaatgggttatagtttctttccgcgatcctgtggatctctccttcctggtatga
EXON 2  273 bp
ttgggctttgcaggctctacagcgtcacacaactattcagctctgctgttgtagtcatga
atggtatgcaagtatgtgggtatgactgtgttccaataaaacacagatttagacttacaa
aaacacgtatactcaaaatgtatattaacatttatccttgtctctcatttttctctgcag
GCAGAAGACTGATTTTTGGAAATATGTATTTGGGAGACAGTCACGTCCTATTGAATACCT
TGTGCTGGTGCTGCCATCGAAAAATCTGGTTACACTCTGGGGAGGACTGCTACCACTGCA
GAACTGAACCACTTCGGCCGTGAGATGAGTGTCCGGCCTGAGCAGGCACACCATGAATAG
ATACACAACAATCAGGCAGCTCGGGGATGGAACCTACGGTTCCGTCCTGCTGGGAAGAAG
CATTGAGTCTGGGGAGCTGATCGCTATTAAAAA
gtaagtttgatccttcactgccatgataattttaactctaccctcaccattacccgtctt
tgtaacagttctaaaggggagtgggtaggatgcctagagaagaaccttagataatgattg
ctgtgggttagatgattattgactctgtaacactcatgttagaggtctgaaaacatttcc
EXON 3  55 bp
aggattattgcactgctgtttgaaaataagtgctggtttgggatagtataatactgggta
gaaatttaaacccactttaagtactgttaattaggatcagaatggaagcatttttctaaa
agcaaagtttaacctattactgagaataagtgtgctgtttgtttctttcttctcttctag
AATGAAAAGAAAATTTTATTCCTGGGAGGAATGCATGAACCTTCGGGAGGTTAAG
gtatatattaatataccaaggaataatttatggatgattaaaatagctttgtacatgctt
agatttatagttgatatagtcatttcatttgaattttttcactaatgctggaaagggagg
caaatgataacattacagctgaagcagaagattatggtataattgtatatactgttatta
EXON 4  122 bp
taaagttattataaatttcagaggtatactattaaactgtcaataaaatataatttagca
catttctgaggttctaaaattagttgtttctttccaagtatacataggattacttttctt
tttcaacaacagattttctctaatatttgttttgttttgtgtttattccttgccttttag
TCTTTAAAGAAGCTCAACCATGCCAATGTAGTCAAATTAAAAGAAGTTATCAGGGAAAAT
GATCATCTTTATTTTATCTTCGAGTACATGAAGGAAAATCTTTACCAGCTCATTAAAGAG
AG
gtacagtttggtcatcattatcttattatagaaataaataggcaaagcagatgtgttttc
tttctgcttttgtgttttctttctctcctttttttctttttttattttttattttttatt
ttattttattattattatactttaagttttagggtacatgtgcacaatgtgtaggttagt
EXON 5  80 bp
ggaggaaaaacttttttttggcttactatcaaatgtttaatctttttgtttttgtaacat
gtgactatatttggtgtttataaggtagctcccctgtatggacaaatggtattctttagt
atttattatcaaaggatctggcctttgatttataactttgttttcctctgcctcatacag
AAATAAGTTGTTTCCTGAGTCTGCTATAAGGAATATCATGTATCAGATATTACAAGGACT
CGCATTTATTCACAAACACG
gtaggtgattcggagtgttgtgcttttgaagagcagtgaaatgttgttatcaagtagaag
ttgtaggaaacattaatattttttgtagctgactcccagaaaaggttgaagagttgagag
gctgacaatggattttaaaatatattaacttttataacttgatctctgaatttccctcat
EXON 6  133 bp
agtaatcctatgagaagttcgaaggactctacattatctgtgggatgaatgcataaagcc
tttggtgccatgccagactactttttaaattataactattttgcagagagcaatacaatt
gcaaagaataatacgaagcaaacttgcatttggatttcttctcctctactgtctctatag
GCTTCTTTCATCGAGACTTAAAGCCTGAGAACCTCCTCTGCATGGGACCAGAACTTGTGA
AAATTGCAGACTTTGGTTTGGCCCGAGAAATACGATCAAAACCTCCATATACAGATTATG
TATCTACCAGATG
gtgaataccatttttctcaaaattatttaattgcacttctttaaaaagatatcattatgc
taaggataatattaaagtcacaaatgttaacttttcactaagagaaacagtgcagtctga
aacatatatttatagatatgttggtaatgtacaaggttaaaaatcttgtgttctaaatca
EXON 7  172 bp
gaagcactacttgtcaacagcagcccacggcagttgccaagttctcacaattccattaca
ccacagtgaactagagagaaaataggaacatatacaccccctcactgagaactgattgtt
atttaatttaatgtctgagtggtggaagcaatagctagcagttaacctttgttcctccag
GTACAGGGCTCCAGAAGTACTCCTGAGGTCTACCAACTACAGCTCCCCCATTGACGTCTG
GGCGGTGGGCTGCATCATGGCAGAAGTTTACACCCTCAGGCCACTCTTCCCTGGAGCCAG
TGAAATTGACACAATATTCAAAATTTGCCAAGTGCTGGGGACACCAAAAAAG
gtaatgatacaaaacaaaggccagtgggccaaagccaacagcttcccatgcttcctccgc
tcagccctgttcagcactggcatgattgagcacctgcccattctaggctctttctcttga
cctcagtcattctccactgcccacgttctcagatacggtcggcttctcttcctcctcctg
EXON 8  168 bp
ctctattaatctaaatctatgtctcattccatacagtgccacagtagtgaatgtgggtgg
ttaatgaatgtgggtgggtaatgacatggttgcctttccatttggggcacacatgccaga
atacaaacttatatcacagcaattggctgagcaagattttctatcttttccttctttcag
ACTGACTGGCCTGAAGGCTATCAACTTTCAAGTGCAATGAACTTCCGTTGGCCACAGTGT
GTACCCAATAACTTAAAGACCTTGATTCCCAATGCTAGCAGTGAAGCAGTCCAGCTCCTG
AGAGACATGCTTCAGTGGGATCCCAAGAAACGACCAACAGCTAGTCAG
gttttcttccattttcttgttataacgttcatatctaactctgaataatttctatgaatt
gcacaggaaatatttagtatttagtattatgggtgagaaatagtacagaataccactaat
ggtgtactatataaggtatgagaacttaaaatagtttgaaacttactgggtataaagtag
EXON 9  321 bp
atattttatggtatcttagataagaaaaatcacaaggggtgttaaaaattcaaggtactg
ttttctaattgggctaagaaacagtagtaaactggtcacaatgaaatatagcccagtaat
caagacagtggtaactttcctggctagacttttctcctaaagccttatttgtcattccag
GCACTTCGATATCCTTACTTCCAAGTTGGACACCCACTAGGCAGCACCACACAAAACCTT
CAGGATTCAGAAAAACCACAGAAAGGCATCCTGGAAAAGGCAGGCCCACCTCCTTATATT
AAGCCAGTCCCACCTGCCCAGCCACCAGCCAAGCCACACACACGAATTTCTTCACGACAG
CATCAAGCCAGCCAGCCCCCTCTGCATCTCACGTACCCCTACAAAGCAGAGGTCTCCAGG
ACAGATCACCCAAGCCATCTCCAGGAGGACAAGCCAAGCCCGTTGCTTTTCCCATCCCTC
CACAACAAGCATCCACAGTCG
gtgagcagcccagattcaccagtgagcttcgtgtctgtttattcctcttctgaccccatt
attgtgtgaaatattttctttttcagtatacagggtccagttatggtagatttatgtttg
caacagcatggaattgtaaagacccttggctttggagtgaaagatctaaattcaagttct
EXON 10  191 bp
tgaaggatgagtgagacagaaagattgggaatgtgttttctacagttgccccttcagata
agcaatgttatgccccaggagcctcctttgcatagcagagaaagttcagatggagattac
tcatggatgagttctgttaatgccaagtattgctttcccccaccccgtttgtttacacag
AAAATCACAGCTGGCCTGGAGCACAAAAATGGTGAGATAAAGCCAAAGAGTAGGAGAAGG
TGGGGTCTTATTTCCAGGTCAACAAAGGATTCAGATGATTGGGCTGACTTGGATGACTTG
GATTTCAGTCCATCCCTCAGCAGGATTGACCTGAAAAACAAGAAAAGACAGAGTGATGAC
ACTCTCTGCAG
gcaagtgtgctgctcacatttgtaaacagactgaatctggaattcatgagattatgggta
catatccgagaatacatactgtctctcgtgctgacccaagccatgctctcttcattcagg
tttgagagtgttttggacctgaagccctctgagcctgtgggcacaggaaacagtgccccc
EXON 11  149 bp
catccctcagcaggattgacctgaaaaacaagaaaagacagagtgatgacactctctgca
ggcaagtgtgctgctcacatttgtaaacagactgaatctggaattcatgagattatgggt
acatatccgagaatacatactgtctctcgtgctgacccaagccatgctctcttcattcag
GTTTGAGAGTGTTTTGGACCTGAAGCCCTCTGAGCCTGTGGGCACAGGAAACAGTGCCCC
CACCCAGACGTCATATCAGCGGCGAGACACGCCCACCCTGAGATCTGCAGCCAAGCAGCA
CTATTTGAAGCACTCTCGATACTTGCCTG
gtaatataaatgacttggctttactttgattattaataagaaaccctgtccttggaatca
catattcacaaaggttctgttttagaaggcagatactagggggcttcccttcagaactga
ggggaacatcatagaaatatttgctgaagcccaagcctcactttttttttgagttggagt
EXON 12  129 bp
accagtgagatatctttcctcggacatctgtcagatgacatcatcacagtcagtttttgc
tttgattattgtatcatagagagtttttgacaaattgagttctgcattaattttatcttt
gtagtctagtgtaagattcattgtgtattttgcattttaaaatcatttcttctctatcag
GGATCAGTATAAGAAATGGCATACTCTCGAATCCAGGCAAGGAATTTATTCCACCTAATC
CATGGTCTAGTTCTGGCTTGTCTGGAAAATCTTCAGGGACAATGTCAGTAATCAGCAAAG
TAAATTCAG
gtgagtaatgatcattaacccctaaatggcaaaaagcaaattccctggatgcaggaaggt
gggcacaaggagtcatgggacgggctttggaagcacaggggcctttgtcatctgaaagct
caggcctcttttccagccctatcctcctctctttctcggcagcagtcccttgggactcag
EXON 13  123 bp
tctttctgacagggtagtatggtgggatgcttggctctgaactcatttttatcatgattt
gctcttttccctaaaagtaaaaacttagtttgttattgctctgcagtgctgtcatttaac
cttgttggtgtcctgggtacatgtctttgtaataatgagctttttgcttttgcaaatcag
TTGGTTCCAGCTCTACAAGTTCTAGTGGACTGACTGGAAACTATGTCCCTTCCTTTCTGA
AAAAAGAAATCGGTTCTGCTATGCAGAGGGTACACCTAGCACCTATTCCAGACCCTTCCC
CTG
gtgagttgtattttaaattattcatgaatttactcaacaaatggttactcaacaactgct
ttgtgccaggcatgttttaggcctgggatccaccaataaatgaaacttgcactctacaga
caataagtaagctaaataagtgctatataacatatagtaagtcagatgcttactgactta
EXON 14  4004 bp
tttggcctgacaactttaaaacgatgtctttaactgcagtagagaagattataagtagga
gacaagatgctcctcttgaactccttattttctcatgtttttgtcaccaaaatgcattta
tttgtactttgcttacattggccccatatcagtcatgccggcctttttctttcattgcag
GTTATTCCTCCCTGAAGGCCATGAGACCTCATCCTGGGCGACCATTCTTCCACACCCAGC
CTAGAAGCACTCCTGGGTTGATACCACGGCCTCCAGCCGCCCAGCCAGTGCATGGCCGGA
CAGACTGGGCTTCCAAGTACGCATCTCGGCGATGACTGTCTGCCTTGGTGATGAATCTCT
TCCTAGGGAGAAGCAGGATACTTTCCCTCAGCTGACTGGTGTTCTACCTGCAAGATGTGC
AGAGGGCATAAAAGCAAATCAACACTTTATAGTTATTCTTCTGAACTAAGACATGTCAAT
ATTCTTTTTTAAAGTTTTTTTTTAAAATATTGATTTGAATGCAGTAGGCTTTTTTGTATA
AAATTATTTTATTCTAAAACTGGGTCCCATTATTTTCTTAAACAACAGCATTTTGTATAT
ATGGATTATGTTTTAGCATTTTATACAGTCAACTTTGTAATGAACTTTTTAAAAATTAAT
TGATTTTCCTTTGGGGTTCCAGATAATATTTTCTACAGATTTTGAAAAATGTAATAATAT
TAATGCAGTATTGCAACAGGGGTGCAATTTAAGGCTATGTGATAGAGGGTTATTTACTCA
GTGTGTGCAGATATTTATGAAGTGGTGAAATTTCAAGTGTGGCTCACTAGGTACTTCAGG
CCTTCTTGGACTGTTGTTAGAAAAGTGATCCTCTGCTTTTCTTAGTAGGTCATTGGTTTG
ATTTTTGGATACCACTCTGCTGTTCTAAAAGGACTATTATATTATATAATTCACTTTGTT
TTACTTTTGTTCCCCAGATGAAAGAACTCTAAGTAAATACATTTTAAAAAATTTTTCTGA
CACCCTTTAATGTGGTTGCAGATCTCAGATGAAACCAAGCTTAATTATACTATGCCATTA
TATTCTAATTTATTCCATTTTTGAAATCAAGTTGTATGTGTACCAATAAAAGAGATTTCT
GCTTCAAAAGGCTCTCAACATGAAGGTTAACACAGTCAATCAAACTTACATTCCTGCCAA
GATGCATGGCCAAAAAACTAAGTATCAAAGCAGCAGAAGGTTTTTGATTATAGTAACTGA
GATGGAATTTTGTGCCTAGCTCAGTTCTCCAGATCTGGCTAGGAGCAGTCAATGACTAAT
GTTCTGTCCTAGCCAAATTCTCAGGACAATTTGGGGAGCAGAAAGAGTTATGGCAGAGGT
TCCACTCATCTACAAAGTCACAGTCACATGCCACATTTGATCTCCTAACCCTGGTGTAGT
TTCTTTCAAGAGTGAGAACTTTATTTGTTGGGCAGAGGCTGTTCCATTGAGAGGAATGTT
TACAGCAGTTTCAAAAATGACAAAGTCAGTTTGGAGACAGAAAAAGACAAAAGGTCCAGT
CTCATCCATCTCTATATGGTACATTTGCCTCACTTATGGTTGCCTTAAAGGCAAGAGGGA
AGGTCACCATCAGTGAACGCAATGCAATCTCAACAGTGTATTGATTCATATTCTCCTAGG
GCTCAAACTACTCTCTATTGGTTCCAGGATAATGACAAATTGAACCATATGTAAGTAATC
TTTTATTTTTTATTTTTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCTGGAGTGCA
GTGGCGCGATCTTAGCTCTCTGCAACCTCTGCCTCCCAGGTTCAAGCCTCCTGAGTAACT
GGGACTACAGGCGCCCGCCACCACGCCCAGCTAATTTTTTGTATTTTTAGTAGAGACGGG
GTTTCACTGTGTTAGCCAGGACGGCCTCGATCTCCTGACCTCGTGATCCACCCTCCTCCA
CCTCCCAAAGTACTGGGATTACAGGCATGAGCCACTGCACCCAGCCAAGTGATCATTTTT
ATAGGTTAAAATGATAGGTGAAATGAATATAGACACTTTCATATGGTTCAACCTAATGAC
TTGGTAAATTATTGCCTTGGTGTATTAATAATATGTTGCATTCTGAACAAATAACCATGG
CTTCCAAAGGGCCCTAACCTAAAATCGGAGAGTAATTTATGCTTTGGAGAATTTGACTCA
AATATATACTTGACCAAGCACCATGATCCCTAGGGGCATGAGAAAAGCACATAATGGATG
TGGATGTGATAGGTGGTCTTTTCCTGTTAACAAGCTGGCAGCAAAGCTTCAGAAAATATA
TATGCAAGCACAACTTGAAGCTGAATTCATTTCTGTATTATATTCTCAACTCGTTATCTA
AAGCATCAGAACATGTGTTTTCAGAGATGAGTCCTTTACTATAAGGTTAATATTTATTTT
CATTTTCTGTATTATATATGAAAAGTAAATTAATGTGAAACCTGGCCCAGCTTGCTGGAA
AGCAGGTTTTAAATTGTAAATATTCCTTAGAGGAGCAAATGGATTGTTTAATACCATAGT
CTCAGTAATCTAGCTTATATAAGGTCATTACATTTTTTAACTGAAAAACCTAGTTACCTG
ATTATTGCACATTATAAAATTGTTTTTCTAATACTTTATAGGGCCCAACTTCAGAAAATA
CTTCGCTTTTTTCTTTTTATGCTTTCGTTTGTTTACCAGCAAGCAACTTCCCTGGGGAAG
CCAAACACATATTCATAAAAAAAATCAAGTAGCTGATGTGCAGTTGAGAAAACTAGAGGA
CTGAAAAAACAAATTTTAACTAGCAAATGCTGTGAATTACTCTTCCTCCCCTTCTCTGAA
ATGGGTAAAGGACAAATTGTGTAAAAAAACCTATGCACTATAGAAGGGAATAGTAACCAT
TTCTTTTGTCTCTCTGTTTCTGTTCTGACTGAGAACCTGCAGCCATTTCTTGTTACATGA
AAACAAAATGCTACTTGTTACCTCTATTTTTTGTTACTATACAATTATGAAATGTAATGT
AAGACACCAACAGAAATGATATACCTGTAACTGTACCTATCAGGACTATACCTCATTTAC
AGTCAGAAAGCTTACTGGGATGTCAGGAAATGATACAGGGTTGGTTCTCATTTCGTGCCG
AAATGAGACAGAAATTCAGTGACGAAGGTGCGTTGTAGGGGTATTGATGTGCCCCAGGTA
GTGCCAGCAGAGTAGGGAAAACTGCATTTGCATAAAAACTACTCTTGACATGATTGTTCA
TTTTACAAAAAAATTCCATTAATTACCAAGCCCTCACCCAGCCCATGTGTGATAGGATTT
ATGTAGGAAGAAACTTGATTTTCAAATAATTTTTTAAATGTATCTCTTGCCTAAAGGACT
ATATACATCTAATAAAGTAACACTGTGTCATCTTCTGGAGTTATCAAAAATTGTATACAA
TCAAGACAACACAAGAATTATTTTATTTTTGAGTGCAAATACAGGTACTGTTGGAGTTGA
TGGGCACCATGCTTTCTCATGAAGTAGCATTTCCCTACCATCAAGCCATTGTTTTGTGCC
ATTCAGGAGAGGAAAAAAAGGAATTTATGCTGTACATTTCAGTTCAGTGTATGACCAAAA
GCAATATGTTTATAAGAAGATGTTTGACATACTAATTATTTTATATCATTTAAACCATAC
TGTAGCAACATAATATATGGAGCTAATTTGTAGAATTATTTTTACGATTTCCAAACAAAT
GTACTGTACTGTTATATAATTTATTGTGAGGACCTTCTCATGGAAGCCATTAGGAAAACA
AACTAGAGGTAAATATCACATTAATCTGTATTATCAATTTCTCATAGACACTGTGCTAAT
GTGAATTTTAAATGACCTGCATCAAGTCTTCTGATCTCAGATAACTCAGTACAGATAGCA
ATTAGTCAGCTGATTTGATTACAATGGAGTAACCGACAATATATTTATTTATAAAGCACA
TATTCATAATAACGAGAAGAATTCAGAAAACCACTTAAGCAAGACCCTTCTGAAATAAAA
AATGTTGCTTTTTAAATAGTTTGTCCTAAGGTGTTTAAAACATGTCAACCTTATGTAAGG
AAAAATTTCCTGGTCCAAATAAAGTTGAAGTTTAAGAAAAATTG
atttgagtgttctgtttttgttttcatgttcttccattagtattttctaatttttgtcct
tagttagtccatttggaacttcgatgttttctaacttctcctgaatgcttagtatctatc
gtgctactgctatgaaattagatgcatgcacttagagcagcagaatgaagagttatcctg