Gene HIST1H2AB Variant 1
DNA : 0.48 KbNT_007592
mRNA : 477 bp NM_003513
CDS : 393 bp NP_003504
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  477 bp
cggaaggattacatgcaaatgaaggatgcagattctgatttcccattgggtatttgacat
tagccaatgggagaattcctcacagcctacctccagtcagtataaatacttctctgcctt
gcgttctaatgtagtttcattacattttcttgtggcgattttcccttatcagaagtagtt
ATGTCTGGTCGCGGCAAACAAGGCGGTAAAGCTCGCGCCAAGGCTAAGACTCGGTCTTCT
CGTGCAGGTTTGCAGTTTCCTGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTAC
TCCGAGCGCGTCGGGGCTGGCGCGCCGGTGTATCTCGCGGCGGTGCTTGAGTACCTGACC
GCCGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACCCGCATCATC
CCGCGCCACCTGCAATTGGCCATCCGCAATGACGAGGAGCTTAATAAACTCTTGGGGCGT
GTGACCATCGCGCAGGGTGGCGTTTTGCCTAATATTCAGGCGGTGCTGCTGCCTAAGAAA
ACTGAGAGCCATCATAAGGCCAAGGGAAAGTGAAGAGTTAACGCTTCATGCACTGCTGTT
TTTCTGTCAGCAGACAAAATCAGCCTAACAGCAAAGGCTCTTTTCAGAGCCACCTAC
gacttccattaaatgagctgttgtgctttggattatgccgcccataaagatgtttttgag
gtgtttttaatggctttgagtgtggcacttttagtaatttgtcctgcagaaattagatcc
atagaaacctcaggaattctaggtatgtgggagaagtgccatgcagcacaaaacatgttt