Gene HIST1H2AA Variant 1
DNA : 0.46 KbNT_007592
mRNA : 465 bp NM_170745
CDS : 396 bp NP_734466
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  465 bp
ctgattggacaatgggaagtggcgtgaatgcaaatgaggcgattctagtacgactttctg
attgggtagacggccatcagccaatcagatagcaaatgccaacctcagtcagactataaa
taggcccagtagcagccctagaaatgtggttctcgtgttgctgcaatttgatgcgaggag
ATGTCTGGACGAGGGAAGCAGGGAGGAAAAGCACGCGCCAAGTCTAAGTCTCGCTCTTCT
AGAGCGGGTTTGCAGTTTCCCGTAGGCCGGATCCATCGTCTGCTTCGTAAGGGAAACTAT
GCAGAGCGGATAGGGGCAGGCGCACCAGTGTATTTGGCGGCAGTGTTAGAGTATCTCACA
GCAGAAATCCTTGAGCTGGCAGGCAATGCGTCTCGCGATAACAAAAAAACTCGCATTATT
CCCCGCCACCTGCAGCTAGCGATCCGCAATGATGAGGAACTCAATAAGCTTTTGGGCGGC
GTGACCATTGCCCAGGGCGGAGTCCTGCCTAACATTCAGGCAGTGCTGCTGCCCAAGAAG
ACTGAGAGTCACCACCATAAAGCCCAAAGCAAGTAACTTAAGGTTGTCATTGGTAAAAAG
ACTTCTGTGTCAGAAAAAACAAAAGGCTCTTTTCAGAGCCACCTA
ccgtctcagaaaaaggctgtacgttacaaaacgttactgctgttaaccagccatcttact
tgcctgtcacaaatgcccgtttaagcgcatttcgggaatgtacggggactgaattttcaa
ggagcgttccatcggccattagtttgaggtaattttggttatatatgtcactgggcgagg