Gene HFE Variant 9
DNA : 6.82 KbNT_007592
mRNA : 1045 bp NM_139006
CDS : 1005 bp NP_620575
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  112 bp
cactggatcacctagtgtttcacaagcaggtaccttctgctgtaggagagagagaactaa
agttctgaaagacctgttgcttttcaccaggaagttttactgggcatctcctgagcctag
gcaatagctgtagggtgacttctggagccatccccgtttccccgccccccaaaagaagcg
GAGATTTAACGGGGACGTGCGGCCAGAGCTGGGGAAATGGGCCCGCGAGCCAGGCCGGCG
CTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGC
gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  264 bp
aagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactc
acccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtgga
gcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccag
GTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCT
TGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTC
GCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGC
AGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTA
TGGAAAATCACAACCACAGCAAGG
gtatgtggagagggggcctcaccttcctgaggttgtcagagcttttcatcttttcatgca
tcttgaaggaaacagctggaagtctgaggtcttgtgggagcagggaagagggaaggaatt
tgcttcctgagatcatttggtccttggggatggtggaaatagggacctattcctttggtt
EXON 3  276 bp
aggttgtcagagcttttcatcttttcatgcatcttgaaggaaacagctggaagtctgagg
tcttgtgggagcagggaagagggaaggaatttgcttcctgagatcatttggtccttgggg
atggtggaaatagggacctattcctttggttgcagttaacaaggctggggatttttccag
AGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGG
GCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGG
ATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGA
TTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGT
TGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAG
gtatggtggaaacacacttctgcccctatactctagtggcagagtggaggaggttgcagg
gcacggaatccctggttggagtttcagaggtggctgaggctgtgtgcctctccaaattct
gggaagggactttctcaatcctagagtctctaccttataattgagatgtatgagacagcc
EXON 4  234 bp
atggtgtctctcctgtagcttgtttttttctgaaaagggtatttccttcctccaacctat
agaaggaagtgaaagttccagtcttcctggcaagggtaaacagatcccctctcctcatcc
ttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttcag
TGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGC
TGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATG
GGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGAT
ATACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGG
gtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcct
gaggaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgaggg
tggcaatcaaaggctttaacttgctttttctgttttagagccctcaccgtctggcaccct
EXON 5  114 bp
cagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatcta
ttgggggttgagaggagtgcctgaggaggtaattatggcagtgagatgaggatctgctct
ttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttag
AGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCG
TCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAA
gtgagtaggaacaagggggaagtctcttagtacctctgccccagggcacagtgggaagag
gggcagaggggatctggcatccatgggaagcatttttctcatttatattctttggggaca
ccagcagctccctgggagacagaaaataatggttctccccagaatgaaagtctctaattc
EXON 6  45 bp
aggtgaggagaccagttagaaagccaataagcatttccagatgagagataatggttcttg
aaatccaatagtgcccaggtctaaattgagatgggtgaatgaggaaaataaggaagagag
aagaggcaagatggtgcctaggtttgtgatgcctctttcctgggtctcttgtctccacag
GAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGACACG
cagcctgcagactcactgtgggaaggagacaaaactagagactcaaagagggagtgcatt
tatgagctcttcatgtttcaggagagagttgaacctaaacatagaaattgcctgacgaac
tccttgattttagccttctctgttcatttcctcaaaaagatttccccatttaggtttctg