Gene HFE Variant 8
DNA : 6.86 KbNT_007592
mRNA : 804 bp NM_139003
CDS : 729 bp NP_620572
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  120 bp
aagggggacactggatcacctagtgtttcacaagcaggtaccttctgctgtaggagagag
agaactaaagttctgaaagacctgttgcttttcaccaggaagttttactgggcatctcct
gagcctaggcaatagctgtagggtgacttctggagccatccccgtttccccgccccccaa
AAGAAGCGGAGATTTAACGGGGACGTGCGGCCAGAGCTGGGGAAATGGGCCCGCGAGCCA
GGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGC

gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  264 bp
aagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactc
acccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtgga
gcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccag
GTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCT
TGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTC
GCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGC
AGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTA
TGGAAAATCACAACCACAGCAAGG
gtatgtggagagggggcctcaccttcctgaggttgtcagagcttttcatcttttcatgca
tcttgaaggaaacagctggaagtctgaggtcttgtgggagcagggaagagggaaggaatt
tgcttcctgagatcatttggtccttggggatggtggaaatagggacctattcctttggtt
EXON 3  234 bp
atggtgtctctcctgtagcttgtttttttctgaaaagggtatttccttcctccaacctat
agaaggaagtgaaagttccagtcttcctggcaagggtaaacagatcccctctcctcatcc
ttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttcag
TGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGC
TGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATG
GGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGAT
ATACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGG
gtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcct
gaggaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgaggg
tggcaatcaaaggctttaacttgctttttctgttttagagccctcaccgtctggcaccct
EXON 4  114 bp
cagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatcta
ttgggggttgagaggagtgcctgaggaggtaattatggcagtgagatgaggatctgctct
ttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttag
AGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCG
TCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAA
gtgagtaggaacaagggggaagtctcttagtacctctgccccagggcacagtgggaagag
gggcagaggggatctggcatccatgggaagcatttttctcatttatattctttggggaca
ccagcagctccctgggagacagaaaataatggttctccccagaatgaaagtctctaattc
EXON 5  72 bp
aggtgaggagaccagttagaaagccaataagcatttccagatgagagataatggttcttg
aaatccaatagtgcccaggtctaaattgagatgggtgaatgaggaaaataaggaagagag
aagaggcaagatggtgcctaggtttgtgatgcctctttcctgggtctcttgtctccacag
GAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGACACGCAGCCTGCAGACTCA
CTGTGGGAAGGA
gacaaaactagagactcaaagagggagtgcatttatgagctcttcatgtttcaggagaga
gttgaacctaaacatagaaattgcctgacgaactccttgattttagccttctctgttcat
ttcctcaaaaagatttccccatttaggtttctgagttcctgcatgccggtgatccctagc