Gene HFE Variant 7
DNA : 9.27 KbNT_007592
mRNA : 1140 bp NM_139005
CDS : 831 bp NP_620574
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  199 bp
ttaaatatctaaagttcagatcagaacattgcgaagctactttccccaatcaacaacacc
ccttcaggatttaaaaaccaagggggacactggatcacctagtgtttcacaagcaggtac
cttctgctgtaggagagagagaactaaagttctgaaagacctgttgcttttcaccaggaa
GTTTTACTGGGCATCTCCTGAGCCTAGGCAATAGCTGTAGGGTGACTTCTGGAGCCATCC
CCGTTTCCCCGCCCCCCAAAAGAAGCGGAGATTTAACGGGGACGTGCGGCCAGAGCTGGG
GAAATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTC
CTGCAGGGGCGCTTGCTGC
gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  264 bp
aagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactc
acccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtgga
gcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccag
GTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCT
TGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTC
GCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGC
AGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTA
TGGAAAATCACAACCACAGCAAGG
gtatgtggagagggggcctcaccttcctgaggttgtcagagcttttcatcttttcatgca
tcttgaaggaaacagctggaagtctgaggtcttgtgggagcagggaagagggaaggaatt
tgcttcctgagatcatttggtccttggggatggtggaaatagggacctattcctttggtt
EXON 3  276 bp
aggttgtcagagcttttcatcttttcatgcatcttgaaggaaacagctggaagtctgagg
tcttgtgggagcagggaagagggaaggaatttgcttcctgagatcatttggtccttgggg
atggtggaaatagggacctattcctttggttgcagttaacaaggctggggatttttccag
AGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGG
GCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGG
ATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGA
TTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGT
TGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAG
gtatggtggaaacacacttctgcccctatactctagtggcagagtggaggaggttgcagg
gcacggaatccctggttggagtttcagaggtggctgaggctgtgtgcctctccaaattct
gggaagggactttctcaatcctagagtctctaccttataattgagatgtatgagacagcc
EXON 4  205 bp
ctccaagtgacactgtgttagagtccaatcttaggacacaaaatggtgtctctcctgtag
cttgtttttttctgaaaagggtatttccttcctccaacctatagaaggaagtgaaagttc
cagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaag
TGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTC
GGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAA
TGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGG
GCTGGATAACCTTGGCTGTACCCCC
tggggaagagcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcat
tgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggggttga
gaggagtgcctgaggaggtaattatggcagtgagatgaggatctgctctttgttaggggg
EXON 5  196 bp
acctctgcctcccaggttcaagcgattctcctgtctcagcctcccaagtagctgggatta
caggcgtgcaccaccatgcccggctaatttttgtatttttagtagagacagggtttcacc
atgttggccaggctggtctcgaactctcctgacctcgtgatccgcctgcctcggcctccc
AAAGTGCTGAGATTACAGGTGTGAGCCACCCTGCCCAGCCGTCAAAAGAGTCTTAATATA
TATATCCAGATGGCATGTGTTTACTTTATGTTACTACATGCACTTGGCTGCATAAATGTG
GTACAAGCATTCTGTCTTGAAGGGCAGGTGCTTCAGGATACCATATACAGCTCAGAAGTT
TCTTCTTTAGGCATTA
aattttagcaaagatatctcatctcttcttttaaaccattttctttttttgtggttagaa
aagttatgtagaaaaaagtaaatgtgatttacgctcattgtagaaaagctataaaatgaa
tacaattaaagctgttatttaattagccagtgaaaaactattaacaacttgtctattacc