Gene HFE Variant 5
DNA : 7.09 KbNT_007592
mRNA : 809 bp NM_139010
CDS : 1293 bp NP_620579
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  236 bp
tttaaatgtatgattgaattttgaaaatcataaatatttaaatatctaaagttcagatca
gaacattgcgaagctactttccccaatcaacaacaccccttcaggatttaaaaaccaagg
gggacactggatcacctagtgtttcacaagcaggtaccttctgctgtaggagagagagaa
CTAAAGTTCTGAAAGACCTGTTGCTTTTCACCAGGAAGTTTTACTGGGCATCTCCTGAGC
CTAGGCAATAGCTGTAGGGTGACTTCTGGAGCCATCCCCGTTTCCCCGCCCCCCAAAAGA
AGCGGAGATTTAACGGGGACGTGCGGCCAGAGCTGGGGAAATGGGCCCGCGAGCCAGGCC
GGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGC
gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  276 bp
ctccaagtgacactgtgttagagtccaatcttaggacacaaaatggtgtctctcctgtag
cttgtttttttctgaaaagggtatttccttcctccaacctatagaaggaagtgaaagttc
cagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaag
TGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTC
GGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAA
TGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGG
GCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGC
ACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGG
gtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcct
gaggaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgaggg
tggcaatcaaaggctttaacttgctttttctgttttagagccctcaccgtctggcaccct
EXON 3  114 bp
cagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatcta
ttgggggttgagaggagtgcctgaggaggtaattatggcagtgagatgaggatctgctct
ttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttag
AGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCG
TCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAA
gtgagtaggaacaagggggaagtctcttagtacctctgccccagggcacagtgggaagag
gggcagaggggatctggcatccatgggaagcatttttctcatttatattctttggggaca
ccagcagctccctgggagacagaaaataatggttctccccagaatgaaagtctctaattc
EXON 4  183 bp
aggtgaggagaccagttagaaagccaataagcatttccagatgagagataatggttcttg
aaatccaatagtgcccaggtctaaattgagatgggtgaatgaggaaaataaggaagagag
aagaggcaagatggtgcctaggtttgtgatgcctctttcctgggtctcttgtctccacag
GAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGACACGCAGCCTGCAGACTCA
CTGTGGGAAGGAGACAAAACTAGAGACTCAAAGAGGGAGTGCATTTATGAGCTCTTCATG
TTTCAGGAGAGAGTTGAACCTAAACATAGAAATTGCCTGACGAACTCCTTGATTTTAGCC
TTC
tctgttcatttcctcaaaaagatttccccatttaggtttctgagttcctgcatgccggtg
atccctagctgtgacctctcccctggaactgtctctcatgaacctcaagctgcatctaga
ggcttccttcatttcctccgtcacctcagagacatacacctatgtcatttcatttcctat