Gene HFE Variant 4
DNA : 7.09 KbNT_007592
mRNA : 1085 bp NM_139007
CDS : 2577 bp NP_620576
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  236 bp
tttaaatgtatgattgaattttgaaaatcataaatatttaaatatctaaagttcagatca
gaacattgcgaagctactttccccaatcaacaacaccccttcaggatttaaaaaccaagg
gggacactggatcacctagtgtttcacaagcaggtaccttctgctgtaggagagagagaa
CTAAAGTTCTGAAAGACCTGTTGCTTTTCACCAGGAAGTTTTACTGGGCATCTCCTGAGC
CTAGGCAATAGCTGTAGGGTGACTTCTGGAGCCATCCCCGTTTCCCCGCCCCCCAAAAGA
AGCGGAGATTTAACGGGGACGTGCGGCCAGAGCTGGGGAAATGGGCCCGCGAGCCAGGCC
GGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGC
gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  276 bp
aggttgtcagagcttttcatcttttcatgcatcttgaaggaaacagctggaagtctgagg
tcttgtgggagcagggaagagggaaggaatttgcttcctgagatcatttggtccttgggg
atggtggaaatagggacctattcctttggttgcagttaacaaggctggggatttttccag
AGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGG
GCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGG
ATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGA
TTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGT
TGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAG
gtatggtggaaacacacttctgcccctatactctagtggcagagtggaggaggttgcagg
gcacggaatccctggttggagtttcagaggtggctgaggctgtgtgcctctccaaattct
gggaagggactttctcaatcctagagtctctaccttataattgagatgtatgagacagcc
EXON 3  276 bp
ctccaagtgacactgtgttagagtccaatcttaggacacaaaatggtgtctctcctgtag
cttgtttttttctgaaaagggtatttccttcctccaacctatagaaggaagtgaaagttc
cagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaag
TGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTC
GGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAA
TGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGG
GCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGC
ACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGG
gtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcct
gaggaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgaggg
tggcaatcaaaggctttaacttgctttttctgttttagagccctcaccgtctggcaccct
EXON 4  114 bp
cagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatcta
ttgggggttgagaggagtgcctgaggaggtaattatggcagtgagatgaggatctgctct
ttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttag
AGCCCTCACCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCG
TCATCTTGTTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAA
gtgagtaggaacaagggggaagtctcttagtacctctgccccagggcacagtgggaagag
gggcagaggggatctggcatccatgggaagcatttttctcatttatattctttggggaca
ccagcagctccctgggagacagaaaataatggttctccccagaatgaaagtctctaattc
EXON 5  183 bp
aggtgaggagaccagttagaaagccaataagcatttccagatgagagataatggttcttg
aaatccaatagtgcccaggtctaaattgagatgggtgaatgaggaaaataaggaagagag
aagaggcaagatggtgcctaggtttgtgatgcctctttcctgggtctcttgtctccacag
GAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAGTGACACGCAGCCTGCAGACTCA
CTGTGGGAAGGAGACAAAACTAGAGACTCAAAGAGGGAGTGCATTTATGAGCTCTTCATG
TTTCAGGAGAGAGTTGAACCTAAACATAGAAATTGCCTGACGAACTCCTTGATTTTAGCC
TTC
tctgttcatttcctcaaaaagatttccccatttaggtttctgagttcctgcatgccggtg
atccctagctgtgacctctcccctggaactgtctctcatgaacctcaagctgcatctaga
ggcttccttcatttcctccgtcacctcagagacatacacctatgtcatttcatttcctat